Also the last member of the D2 receptor family,
D4 receptor, is palmitoylated on its terminal cysteine residue Cys467.
Dopamine
D4 receptor oligomerization--contribution to receptor biogenesis.
* Dopamine
D4 Receptor * Kappa Opioid Receptor * Galanin
Rubinstein, "Identification of brain neurons expressing the dopamine
D4 receptor gene using BAC transgenic mice," European Journal of Neuroscience, vol.
Polymorphic variation in the dopamine
D4 receptor predicts delay discounting as a function of childhood socioeconomic status: evidence for differential susceptibility.
Dopamine
D4 receptor primer; gatgtgttggacgcctttct; tcggcattgaagatggtgta
"We are the only group that knows, through our experimental work, what the
D4 receptor does, which activation causes decreased motor activity, because it would be acting in this special kernel that controls attention and partly motor activity'" Aceves Ruiz said.
Dopamine
D4 receptor gene polymorphism is associated with attention deficit hyperactivity disorder.
Dopamine
D4 receptor (D4DR) exon III polymorphism associated with the human personality trait of Novelty Seeking.
Leukotriene
D4 receptor antagonist montelukast alleviates protamine sulphate-induced changes in rat urinary bladder.
Here's an actual example: "The variable number tandem repeats (VNTR) polymorphism in exon III of the human dopamine
D4 receptor gene (DRD4) has been correlated with an array of behavioral phenotypes."
Emanuele and colleagues (2007) looked for associations between markers in neurotransmitter genes (the serotonin transporter gene, 5-HTT; the serotonin receptor 2A, 5HT2A; the DA D2 receptor gene, DRD2; and the DA
D4 receptor gene, DRD4) and the six styles of love (eros, ludus, storge, pragma, mania, and agape).