CYP11A1

CYP11A1

A gene on chromosome 15q23-q24 that encodes a member of the cytochrome P450 superfamily of enzymes, which catalyse reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. CYP11A1 localises to the mitochondrial inner membrane and catalyses the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones.
Mentioned in ?
References in periodicals archive ?
34],[35],[36] In the estradiol biosynthesis pathway, cholesterol transports by STAR from the outer membrane to the inner membrane of the mitochondria, and then by CYP11A1, it converts to pregnenolone.
At levels equivalent to, or even exceeding, half-maximal suppressions of testosterone synthesis by all of the 11 chemicals, the tissues appeared intact and well organized, with the expression of CYP11A1 clearly visible (Figure 2A,B).
Steroidogenesis is modulated through the regulation of the genes involved in the hypothalamic-pituitary--steroidogenetic axis, such as: STAR, CYP11A1, CYP17A1, CYP19A1, LH and INHA(30).
Transfers electrons from adrenodoxin reductase to CYP11A1, which catalyzes cholesterol side-chain cleavage FDXR Electron transport flavoprotein for mitochondrial P450s.
The primers used for the amplification of CYP17A1 (sense: CCATCAGAGAAGTGCTCCGAAT and antisense: GCCAATGCTGGAGTCAATGA), CYP11A1 (sense: CTTGCACCTTTCTGGCTAGG and antisense: AAGGGGAAGAGGTAGGGTGA), HSD3B2 (sense: GCCCAACTCCTACAGGGAGAT and antisense: TTCAGAGCCCACCCATTAGCT) and STAR (sense: CCCAGCAGAAGGGTGTCATC and antisense: TGCGAGAGGACCTGGTTGAT) were based on previous studies (GASPERIN et al.
Those associated with the mitochondrial membrane are P450scc (now termed CYP11A1 (65,66)) responsible for cholesterol side-chain cleavage reaction, [P450.
Members of CCAAT box family are known to be associated with CYP11A1, CYP17 and 3[beta]HSD as well as genes related to their action such as GLUT4 and peroxisome proliferator activated receptor-gamma (PPAR-[gamma]).
Ovarian expression of ERa/p, 3[beta]HSD, 17PHSD1, CYP11A1 and StAR mRNA in neonatal piglets was not affected by maternal dietary protein restriction.
We used same antibodies utilized for Western blot analysis, but at different concentrations; 1:100 for CYP19, 1:1,000 for CYP11A1, 1:200 for HSD17B4, 1:500 for CBR1, 1:500 for CYP17A, 1:200 for AKRIB1, and 1:500 of HSD3B.