Also found in: Encyclopedia.


A gene on chromosome 2q35 that encodes a seven-transmembrane G protein-coupled receptor belonging to the CXC chemokine receptor family, which selectively binds IL8. IL8 binding activates neutrophils via a G protein-coupled receptor, which in turn activates the phosphatidylinositol-calcium second messenger system.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Combination of IL-8 and CXCR1 or CXCR2 at high-affinity can activate target cells (such as human polymorphonuclear leukocytes) and further activate the downstream tyrosine kinase cascade signal transduction pathway (Futosi and Mocsai, 2016), produce a host of chemotactic small molecules, and recruit more neutrophils quickly migrating through the vascular endothelial cell to facilitate their participation in local or systemic tissue injury and repair (de Oliveira et al., 2016; El-Benna et al., 2016).
Gene Forward (5' [right arrow] 3') Cxcr2 atccaccttgaattctcccatc Il6ra cctctgacttccatttctgct Cxcr1 tcccgtgatatttccaaattctttc Ccr3 ggtgcccactcatattcatagg Ccr5 gtgctgacataccataatcgatg Ccr1 aggaactggtcaggaataatagc Gpr75 tcaggatctcagctcacaga Ccr2 actgaggtaacatattattgtcttcca Cx3cr1 cacaatgtcgcccaaataacag Cyclophilin tggagagcaccaagacagaca Gene Reverse (5' [right arrow] 3') Product length (bp) Cxcr2 gcctcactttcttccagttca 145 Il6ra caagaatcctcgtccatgtcc 118 Cxcr1 tcccgcacacaaggaac 120 Ccr3 ctactggactcataaaggacttagc 125 Ccr5 tgtcttcatgttagatttgtacagc 147 Ccr1 caaaggcccagaaacaaagtc 125 Gpr75 agatagggtcactactgcga 102 Ccr2 gagccatacctgtaaatgcca 148 Cx3cr1 tcccttcccatctgctca 112 Cyclophilin tgccggagtcgacaatgat 66 Table 2: Cytokines/chemokines receptors name and its ligands.
(HIF-1[alpha]) and interleukins (IL-6, IL-8, IL-10) as well as IL-8 receptors CXCR1 and CXCR2, matrix metalloproteinases (MMP2 and MMP9) and vascular endothelial growth factor (VEGF) and decreased expression of leukemia inhibiting factor (LIF), LIF receptor [alpha], and IL-11 may be linked to adenomyosis-associated infertility (v) Decreased expression of HOXA-10 gene during the midluteal phase, which is considered a necessary component of endometrial receptivity and peaks during the implantation window, may negatively affect implantation (vi) Hyperestrogenic endometrial environment due to the increased expression of cytochrome P450 along with increased aromatase activity in the endometrium sustains the increased expression of the estrogen receptor [alpha] during the secretory phase.
Autocrine regulation of re-epithelialization after wounding by chemokine receptors CCR1, CCR10, CXCR1, CXCR2, and CXCR3.
Global Markets Direct's, 'C-X-C Chemokine Receptor Type 1 (CDw128a or High Affinity Interleukin-8 Receptor A or IL-8 Receptor Type 1 or CD181 or CXCR1) - Pipeline Review, H1 2016', provides in depth analysis on C-X-C Chemokine Receptor Type 1 (CDw128a or High Affinity Interleukin-8 Receptor A or IL-8 Receptor Type 1 or CD181 or CXCR1) targeted pipeline therapeutics.
This variable highly correlated with the ARGs PPIA (0.92), CUL5 (0.51), TSG101 (0.48), IDH1 (0.17), and PECI (0.15), but not GML (-0.16), APOBEC3G (-0.17), MYH9 (-0.17), IL4 (-0.18), TLR9 (-0.18), CXCR1 (-0.25), HLA-C (-0.26), NCOR2 (-0.28), DC-SIGN (-0.29), and TLR8 (-0.36).
Other GPCRs that stimulate invasion with extracellular signal-regulated kinase (ERK) and matrix metalloproteinase 9 (MMP-9) activation include chemokine (C-X-C motif) receptors CXCR1 and CXCR2 (56,57) and CXCR4.
Introduction of additional markers allowed for further characterization of these subsets indicating that CD14lowCD16+ monocytes expressed higher levels of CD43, CD115, CXCL16, CXCR1 and C3AR1 expression whereas CD14highCD16- monocytes exhibited higher levels of CD1d, CD93 and CD114.
Montini et al., "Interleukin-8 and CXCR1 receptor functional polymorphisms and susceptibility to acute pyelonephritis," Journal of Urology, vol.
Further, mice deficient in CXCR1, a neuronal chemokine receptor involved in NK cell recruitment into the CNS, were found to have increased EAE-related mortality and severity of inflammatory lesions [148].