CXCL3


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.

CXCL3

A gene on chromosome 4q21 that encodes a chemokine with chemotactic activity for neutrophils. CXCL3 may play a role in inflammation and act on endothelial cells in an autocrine fashion.
Mentioned in ?
References in periodicals archive ?
Ulteriorly, fifteen module-related DEGs were obtained according to PPI network and modular analyses with a score no less than 4, namely, CXCL2, CXCL1, BDKRB1, LPAR1, CXCL3, FYN, COL6A2, COL18A1, COL13A1, COL5A1, TUBA1A, FDFT1, SQLE, LSS, and CDK9.
Target Primer Sequence (5'-3') TNF-[alpha] F TTCTGTCTACTGAACTTCGGGGTGATCGGTCC R GTATGAGATAGCAAATCGGCTGACGGTGTGGG IFN-[gamma] F ACTGGCAAAAGGATGGTGAC R TGAGCTCATTGAATGCTTGG IL-6 F AACGATGATGCACTTGCAGA R GAGCATTGGAAATTGGGGTA MCP-1 F CCCACTCACCTGCTGCTACT R TCTGGACCCATTCCTTCTTG Cxcl3 F AGGCTACAGGGGCTGTTGT R GGGTTGAGGCAAACTTCTTG IR F GAGATGGTCCACCTGAAGGA R GGACAGACATCCCCACATTC IRS-1 F AAGCACCTGGTGGCTCTCTA R TCAGGATAACCTGCCAGACC IRS-2 F ATACCGCCTATGCCTGTCTG R TGGTCTCATGGATGTTCTGC GAPDH F AGTCCATGCCATCACTGCCACC R CCAGTGAGCTTCCCGTTCAGC Table 2: Calorie and composition of Seyoeum.
A specific primer for CXCL3, NME7 and C5 is as follows: CXCL3: FW: GGCTTTCCAGTCTCAACCAT, REV: GGCGGGACTTACATGACTTC; NME7: FW: GTCCTGACCAACCTCTTGGA, REV: GCAGTACCCCATAGACTGGTG; C5: FW: TTTCAGGACTGCTTGTAGGTGA, REV: AACTGGAGGAATGGAGTTTCC.
As obviously shown in Figure 7(a), the mRNA expression of CXCL3, ELF5, and TIMP1 significantly increased in CRC tissues compared with matched adjacent normal tissues, whereas PHLPP2 mRNA expression was decreased in CRC tissues; and these results were further confirmed by TCGA database (Figure 7(b)).
In comparison to wt mice, TCDD-treated AhRR Tg mice had significantly lower expression of CXCL2 and CXCL3 (Figure 4).
Additionally there also were genes related to the CXC family of chemokines (MCP-1, IL-8, CXCL1, CXCL2, CXCL3, and CXCR4).
We next matched genes in these three pathways with the 163 genes and identified 12 candidate genes: B-cell CLL/lymphoma 6 (BCL6), IL1[alpha] (ILIA), IL8, PTGS2, DTR, chemokine (C-X-C motif) ligand 3 (CXCL3), promyelocytic leukemia (PML), sine oculis homeobox homolog 1 (Drosophila) (SIX1), tumor necrosis factor (TNF), [alpha]-induced protein 3 (TNFAIP3), Zn finger and BTB domain containing 1 (ZBTB1), Zn finger protein 44 (KOX 7) (ZNF44), and Zn finger protein 450 (ZNF450).
In castration-resistant prostate cancer from the xenograft mice, release of IL-1[alpha] from the necrotic primary cancer cells results in CXCL3 secretion, which, in turn, recruits B cells.
The ELR-motif-positive CXC chemokines, CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8, directly promote the migration and proliferation of endothelial cells and eventually neovascularization, mainly by interacting with CXCR2 but not with CXCR1 [37].
Angiogenic chemokines, such as CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, and CXCL8, are generally distinguished by an ELR motif.
Additional chemokines are upregulated by LOX-1 activation in response to OxLDL, including IL-8, chemokine (CX-C motif) ligands 2 and 3 (CXCL2 and CXCL3) [19].
OxLDL administration was also shown to induce the production of IL-6 from HUVECs [20], chemokines CXCL2 and CXCL3 from LOX-1 overexpressing human aortic endothelial cell line [35], MCP-1 from human articular chondrocytes [36], and the intestinal tissue of animals with endotoxemia [1].