CSF3


Also found in: Dictionary, Acronyms.

CSF3

A gene on chromosome 17q11.2-q12 that encodes colony stimulating factor 3 (granulocyte), a cytokine that controls the production, differentiation and function of granulocytes, the active protein product of which is located extracellularly.
References in periodicals archive ?
Gene Forward Reverse Beta-actin TC CCAAAG CCAACAGAGAGAA CACCAGAGTCCATCACAATACCA Csfla ACTGTGCCCAGAG CAG CTTT CCTCACAGTT CCAGTCCACAG A Csf3 GTGTGCAGCGGATGCTCAT CTGCGAGGTCGTTCAGTAGGTT MPO GCTGCTGTTGTGCTCTTTCA TTGAGTGAGCAGGTTTGTGG GA TA-1 CAGTTCAGCAGCGCTCTATTCA AGCCTCAGGTGGCGAAAGT GA TA-2 CCACTGCAAGAATGGACGAA GCCAAGCTTCCCCGAAGA Table 2: Histopathological assessment lesions observation of the liver.
matyti, kad po 5 tyrimo savaiciu CSF3 uzterstame dirvozemyje auksciausios buvo svidres, kurios uz kontrolinius (15,38 cm) buvo zemesnes 3,9 cm esant 3 g/kg CSF3, 4,06 cm--esant 5 g/kg CSF3, 4,67 cm esant 10 g/kg CSF3 ir labiausiai skyresi nuo kontroliniu augalu antzemines dalies aukscio.
Po 6 eksperimento savaiciu svidres tiriamuju augalu antzemines dalies aukstis uz kontroliniu augalu auksti (17,44 cm) buvo mazesnis 2,88 cm esant 3 g/kg CSF3 dirvozemyje, 4,3 cm--5 g/kg CSF3 dirvozemyje, 5,38 cm--10 g/kg CSF3 dirvozemyje.
4-aja savaite 5 g/kg CSF3 uzterstame dirvozemyje svidres augalu fitomase buvo 1,29 cm didesne (12,45 cm) uz 3 g/kg CSF3 uzterstame dirvozemyje augusiu augalu fitomase (11,16 cm) (6 pav.).
Analizuojant tikrojo eraicino fitomases kitima Clearway SF3 uzterstame dirvozemyje matyti, kad 3 g/kg CSF3 uzterstame dirvozemyje eraicino fitomase buvo artima kontroliniu augalu fitomasei, isskyrus 3-iaja tyrimu savaite, kai nustatytas didziausias fitomases skirtumas--1,89 cm.
Activator protein-1 (AP-1) is recognized as a regulator of the expression of cytokines, such as CSF3, IL-6, and TNF, and is causally involved in PS and RA [44].
The deregulation of certain key molecules, such as ERK1/2, CSF3, FOS, IFNG, and TNF, as well as the perturbation of signaling pathways, including the complement system, antigen presentation, macropinocytosis signaling, NF-[kappa]B signaling, IL-6 signaling, IL-17 signaling, and p38 MAPK signaling, reflected this type of imbalance.
Abbreviations PS: Psoriasis RA: Rheumatoid arthritis PBMCs: Peripheral blood mononuclear cells PV: Psoriasis vulgaris PASI: Psoriasis area severe index BSA: Body surface area DAS28: Disease activity score in 28 joints BMI: Body mass index ESR: Erythrocyte sedimentation rate CRP: C-reactive protein RF: Rheumatoid factor WBC: White blood cell HGB: Hemoglobin PLT: Platelets IL: Interleukin Th: T helper Treg: Regulatory T cells TNF: Tumor necrosis factor CSF3: Colony-stimulating factor 3 IFN[gamma]: Interferon gamma IFNG: Interferon gene NF-[kappa]B: Nuclear factor-kappa B MAPKs: Mitogen-activated protein kinases ERK1/2: Extracellular signal-regulated kinase 1/2 NGS: Next-generation sequencing.