CREBBP


Also found in: Dictionary, Financial, Acronyms, Encyclopedia.
Related to CREBBP: EP300

CREBBP

A gene on chromosome 16p13.3 that encodes a ubiquitously expressed protein involved in the transcriptional coactivation of various transcription factors. CREBBP acts as a scaffold to stabilise additional protein interactions with the transcription complex; it has intrinsic histone acetyltransferase activity, and acetylates both histone and non-histone proteins.

Molecular pathology
CREBBP mutations cause Rubinstein-Taybi syndrome (RTS); chromosomal translocations of CREBBP are associated with acute myeloid leukaemia.
References in periodicals archive ?
Gene Forward primer (5'-3') Reverse primer (5'-3') P300 CTGTATGTGCTCCAGAAC GACAAAAAGGCAGTTCC CREBBP CTGCACACGACATGACT GAAGTGGCATTCTGTTG HDAC1 CAAGCTCCACATCAGTCCTTCC TGCGGCAGCATTCTAAGGTT HDAC2 AGTCAAGGAGGCGGCAAAA TGCGGATTCTATGAGGCTTCA HDAC7 CTTCTCCACAAGGACAAG CTCCAGGGTTCTGTAGG [beta]-actin GCACCACACCTTCTACAATGAGC GGATAGCACAGCCTGGATAGCAAC TABLE 3: Correlation analysis of global histone H3/H4 acetylation in [CD4.sup.+] T lymphocytes from LADA patients.
For immunoprecipitation studies, mouse monoclonal antibody against human CREBBP (C-1, 20 [micro]g; Santa Cruz Biotechnology) was incubated with 10 [micro]l of protein A Sepharose beads (Amersham Pharmacia) at 4[degrees]C for 4 h (Imakawa et al., 2006; Sakurai et al., 2009; 2010).
Similar levels of transcription factor CREBBP, JUN, ETS2 mRNAs were found this time period whereas IFNT mRNA declined (Figure 1A).
To evaluate the role of CREBBP on IFNT transcription, JEG-3 cells were cotransfected with the -654-IFNT-Luc construct along with Jun, Ets2, and/or Cdx2 expression plasmids, either with or without Oct4 or a CREBBP inhibitor, 12S E1A.
The mutational landscape of ocular marginal zone lymphoma identifies frequent alterations in TNFAIP3 followed by mutations in TBL1XR1 and CREBBP. Oncotarget.
pombe); CHUK, conserved helix-loop-helix ubiquitous kinase; CREBBP, CREB binding protein (also known as CBP); CUL2, cullin 2; DAPK1, death-associated protein kinase 1; DAPK2, death-associated protein kinase 2; DAPK3, death-associated protein kinase 3; DGCR8, DiGeorge syndrome critical region gene 8; DROSHA, drosha, ribonuclease type III; E2F1, E2F transcription factor 1; EGF, epidermal growth factor; EGFL7, EGF-like-domain, multiple 7; EGFR, epidermal growth factor receptor; EGLN1, egl nine homolog 1 (C.