CPS1


Also found in: Acronyms, Wikipedia.

CPS1

A gene on chromosome 2q35 that encodes a mitochondrial enzyme which catalyses synthesis of carbamoyl phosphate from ammonia and bicarbonate, a reaction that is the first committed step of the urea cycle and important in removing excess ammonia from cells.

Molecular pathology
Defects of CPS1 cause carbamoyl phosphate synthetase deficiency, and increase susceptibility to persistent pulmonary hypertension and venoocclusive disease after bone marrow transplantation.
References in periodicals archive ?
A majority (94%) of these sequences mapped to a specific section of approximately 1800 bp in CPS1, a region for which no capture probes had been designed (Fig.
Capturing the complete genomic regions of OTC, CPS1, and NAGS permitted the simultaneous and comprehensive screening for disease-causing mutations in 3 genes involved in inborn UCDs.
7] Human genes: CPS1, carbamoyl-phosphate synthetase 1, mitochondrial; NAGS, N-acetylglutamate synthase; OTC, ornithine carbamoyltransferase.
m], and a lower tiling density than probes for OTC or CPS1 (see Table 3 in the online Data Supplement), suggesting that NAGS has sequence properties that are more challenging for MSC and NGS.
m]s of the PCR products are large, they can be distinguished from each other using only SYBR Green I dye, as shown in the detection of the 9-bp deletion in CPS1 deficiency.
Name Role Position [alpha]-GAL 2Del-S PCR primer 10 928 (a) 2Del-AS PCR primer 11 114 2Del-F Probe 10 995 2Del-LC Probe 11 016 CPS1 9Del-S PCR primer 811 (b) 9Del-AS PCR primer 865 Name Sequence (5' [right arrow] 3') Modification [alpha]-GAL 2Del-S GGGCCACTTATCACTAGTTGC None 2Del-AS TGATGAAGCAGGCAGGAT None 2Del-F GTGGGAACGACCTCTCTCAG 3'-Fluorescein 2Del-LC CTTAGCCTGGGCTGTAGCTATGATA 5'-LC Red 640 3'-Phosphorylation CPS1 9Del-S GCAGAACCACTAATTCAG None 9Del-AS GCTCCTTGCGATCACTCT None (a,b) Positions of primers and probes at the 5' termini, according to GenBank accession number: (a) X14448 for [alpha]-GAL and (b) Y15793 for CPS1.