glucarpardase

(redirected from CPG2)

glucarpardase

A bacterial enzyme that rapidly metabolises methotrexate, which can be used to treat accidental overdose.
References in periodicals archive ?
[USA], Jan 09 (ANI): A new research conducted at The Picower Institute for Learning and Memory at MIT finds that the protein CPG2 is significantly less abundant in the brains of people with bipolar disorder (BD).
[USA], Jan 09 ( ANI ): A new research conducted at The Picower Institute for Learning and Memory at MIT finds that the protein CPG2 is significantly less abundant in the brains of people with bipolar disorder (BD).
Evaluation of the individual CpG sites based on multiple linear regression models suggested that associations were strongest with four of the seven individual CpG sites (CpG1: -1.5%; 95% CI: -3.1, 0.10%; p = 0.06; CpG2: -1.4%; 95% CI: -2.8, -0.03%, p = 0.05; CpG3: -1.3%; 95% CI: -2.7, -0.008%, p = 0.05; and CpG5: -1.8%; 95% CI: -3.4, -0.09%, p = 0.04) (Figure 2).
Methylation at the CpG2, 3, and 5 sites, which flank the transcription factor sequence as well as the TATA box region, was significantly lower in association with an IQR increase in second-trimester [PM.sub.2.5] air pollution.
Measurement Mean (range) 3-NTp (nM/mg protein) (a) 3,703 (100-23,681) LEP methylation (%) CpG1 10.0 (0.53-42.9) CpG2 12.7 (0.66-38.0) CpG3 8.5 (0.91-34.9) CpG4 61.5 (33.5-88.6) CpG5 13.6 (2.0-34.9) CpG6 13.5 (1.1-38.2) CpG7 22.3 (0.52-47.6) (a) 3-Nitrotyrosine, geometric mean (range), n = 313.
Hypermethylation was seen in both supplementation groups at CpG4 CD + EGCG (172%) and HFD + EGCG at CpG2 with an increase of 80% normalized to, respectively, CD or HFD (p [less than or equal to] 0.01).
In colon cells the methylation status of MLH1 showed a significant reduction at CpG2 in HFD compared to CD (60%; p [less than or equal to] 0.01).
Methylation of CpG2 (adjusted P = 0.013) and CpG3 (adjusted P = 0.039) was significantly lower in healthy males than in healthy females after adjusting for confounding factors (Table 3 and Figure 2).
In addition, we found that methylation of CpG2 and CpG3 was significantly different between males and females in healthy controls.
where y was the CpG of interest (i.e., CpG1, CpG2, or CpG3), [P.sub.total M] was the arithmetic sum of all P, where the CpG of interest methylation status was M, and where [P.sub.total U] was the arithmetic sum of all P where the CpG of interest methylation status was U.
The primer sequences of MeDIP analysis Name Primer sequences (5' to 3') BMP4 CpG1 F: AACTGGGAACAGGCTTAGGAA R: GACCCTCGAAACTGAATCTGC BMP4 CpG2 F: GACCTGCCTTCCAGAGTCCA R: CCGCAGTCAAGTGGGAGAA PCNA CpG F: CCGCATCTGCAACCTATACCA R: CGAATCCGACTAGGAACCATG CYP19A1 CpG F: ATCGTGGAGCAGTGGTTA R: GTCGAATCGGAGCCTTAG mc1 F: CCCTATAACGCCTTGCCAAACC R: GGGTAGGTGCCTGCTTTCGTAG MeDIP, methylated DNA immunoprecipitation; F, forward; R, reverse; BMP, bone morphogenic protein; PCNA, proliferating cell nuclear antigen; CYP19A1, cytochrome P450 aromatase; mc1, methylation control 1.
MSQMA provides combined methylation output from 10 CpG sites (CpG2 to -12), including those with methylation reported to change with age (16), those that have stable methylation over time, and 3 additional CpG sites for which the methylation status could not be analyzed by MALDI-TOF MS owing to their fragments being too large.