COL2A1


Also found in: Acronyms, Wikipedia.

COL2A1

Notation for the collagen type II α-1 gene.
References in periodicals archive ?
A reduction in the expression of Col2a1, a known Sox9 target, was observed as expected when Sox9 was inactivated (Figure S2).
As shown in Figure 7, GAG and COL II secretion increased significantly in the T-SiT[beta]RIII group (Figures 7(a) and 7(b)), as well as mRNA levels of cartilage-specific genes (SOX9 and COL2A1), as compared with that in the T-SiNC group (Figure 7(c); P < 0.05).
Genes Sequences of primer (5'-3') ALP Forward: TGGTACTCGGACAATGAGATGC Reverse: GCTCTTCCAAATGCTGATGAGGT Collal Forward: AGAGGCATAAAGGGTCATCGTG Reverse: CAGGTTGCAGCCTTGGTTAGG Runx2 Forward: CAGTATGAGAGTAGGTGTCCCGC Reverse: AAGAGGGGTAAGACTGGTCATAGG PPAR[gamma] Forward: CCCTTTACCACGGTTGATTTC Reverse: CTTCAATCGGATGGTTCTTCG AP2 Forward: CTTGGTCGTCATCCGGTCAG Reverse: CCAGGGTTATGATGCTCTTCACT LEP Forward: CTTTGGTCCTATCTGTCCTATGTTC Reverse: GAGGATCTGTTGATAGACTGCCA SOX9 Forward: AGGCCACCGAACAGACTCAC Reverse: GAAGGTCTCGATGTTGGAGATGA ACAN Forward: ACAGACACCCCTACCCTTGCT Reverse: CCTCACATTGCTCCTGGTCG Col2a1 Forward: GTGGAAGAGCGGAGACTACTGG Reverse: TTGGGGTAGACGCAAGACTCG [beta]-Actin Forward: TGCTATGTTGCCCTAGACTTCG Reverse: GTTGGCATAGAGGTCTTTACGG
The pGL3-Luc::hCOL2A1, pGL3-Luc:: hCOL1A2, and pGL3-Luc::hCOL10A1 plasmids were built by cloning full length human COL2A1, COL1A2, or COL10A1 mRNA 3-UTRs into the pGL3 Luciferase Reporter Vector (Promega), respectively.
ADSC pellets cotreated with these two growth factors displayed increased GAG accumulation, improved histologic appearance with intense Alcian blue and Sirius red staining signal, and increased transcription of cartilage-related genes, such as aggrecan, Sox-9, Col2a1, and Prg4.
COL2A1 and PRG4 expression also showed a similar pattern as shown in Figure 4 (Figures 5(e) and 5(f)).
Chondrogenic differentiation capacity was confirmed by qRT-PCR for chondrogenic markers ACAN and COL2A1 in P2 and P15 of (b) hPDLSCs ((A3) and (B3), resp.) and (d) MS-hPDLSCs ((C3) and (D3), resp.).
(a) Quantitative real-time PCR analysis of chondrogenic marker genes SOX-9, COL2A1, ACAN, and CUL10A1 at ELSC, MLSC, and LLSC in MSCs and ASCs following pellet culture for 21 days in chondrogenic media.
We also assessed RNA from IGF-1-transduced cells and control cells for mRNA transcript levels for the chondrogenic marker gene type II collagen alpha1 (Col2A1), as well as the hypertrophic marker type X collagen (Col10), matrix metalloproteinase 13 (MMP-13), and the osteogenic marker genes ALP and Osterix.
Identification of a novel mutation in the COL2A1 gene in a Chinese family with spondyloepiphyseal dysplasia congenita.
Primers synthesized by Invitrogen for collagen type I (Col1A1), osteonectin (ON), collagen type II (Col2A1), aggrecan (ACAN), and fatty-acid-binding protein-4 (FABP4) were used in this study (Table 2).
Gene expression microarray studies have shown differences in gene expression between PMA and PA, whereby PMAs overexpress the developmental genes H19 and DACT2, extracellular matrix collagens (COL2A1; COL1A1), and IGF2BP3.