CENP


Also found in: Acronyms.

CENP

Centromere autoantigens to which autoantibodies form in patients with systemic sclerosis.
Farlex Partner Medical Dictionary © Farlex 2012
Mentioned in ?
References in periodicals archive ?
The EUROLINE test (Euroimmun AG) enabled detection of 14 autoantibodies against RNP, Sm, Ro/SSA60, Ro/SSA52, La/SSB, Scl-70, Pm-Scl, Jo-1, CENP, PCNA, nucleosomes, histones, ribosomal-P, and AMA-M2.
From those, 83 patients were found Ro52 positive without any other autoantibody that could be detected in relevant systemic autoimmune diseases (Sm, RNP, SS-A (60 kD), SS-B, Scl-70, PM-Scl, Jo-1, CENP B, PCNA, dsDNA, Nucleosomes, Histones, Ribosomal P-Protein, AMA M2, and Citrulline Peptide).
The quantification of 17 alpha overexpression in transformed cells was conducted by real-time PCR, using the PerfeCta SYBR Green Mix (Quanta Biosciences) on an iCycler machine (Bio-Rad) with the following primers: 17[alpha]Sat6F TTGTGGTTTGTGGTGGAAAA and 17[alpha]Sat6R CTCAAAGCGCTCCAAATCTC, and compared to that of a gene homogenously expressed in all cells (CENP B).
Also Anti-ENA (Extractable Nuclear Antigen) assay was performed with commercial kits (Euroline ANA Profile 1 Euroimmun) based on Immunblotting method with each strip containing nRNP/Sm (U1-nRNP) Sm SS-A Recombinant Ro-52 (Ro-52 52kDa) SS-B DNA- Topoisomerase I (Scl-70) PM-Scl Histidyl-tRNA synthetase (Jo-1) Centromer protein B (CENP B) Double stranded DNA (dsDNA) and Nucleosome Histone antigens.
(19) investigaram o Programa de Nutricao e Fortalecimento do Crescimento Infantil (CENP) em uma area rural do Vietname.
Wheeler, PhD, RN, CENP, is associate dean, Cleveland State University, Cleveland, Ohio.
Fortunately for me, however, that call came the next day from Anna Holliday, CENP, a nurse practitioner in our hospital's occupational health department Anna asked me to come over to her office to discuss "the situation," as she described it Once again, I was presented with the laundry list of potential side effects of anti-retroviral therapy.
A despeito das resistencias, a Proposta de Historia da Coordenadoria de Estudos e Normas Pedagogicas (CENP), cuja versao final so e publicada e distribuida aos professores da rede publica estadual paulista em 1992, fundamenta-se em um itinerario pedagogico que valoriza procedimentos para a construcao do conhecimento pelo aluno de maneira autonoma, em oposicao a uma metodologia de ensino voltada a transmissao de informacoes provenientes da ciencia de referencia.
Common immunofluorescence antinuclear antibodies patterns associated with specific diseases (6) ANA Antigen Associated pattern diseases Speckled ENA, RNP, Sm, SLE, MCTD, Ro/SSA, Systemic La/SSB, sclerosis, Scl-70, Jo-1, Sjogren's ribosomal-P syndrome, PM Homogenous dsDNA, SLE, Histones Drug-induced SLE Peripheral RNP, Sm, SLE, Systemic (rim) Ro/SSA sclerosis Nucleolar Anti-PM-Scl, Systemic anti-RNA sclerosis, polymerase PM I-III, anti-U3- RNP, To RNP Centromere CENP A-E Limited systemic sclerosis ENA: Extractable nuclear antigens; RNP: Ribonucleoproteins; SLE: Systemic lupus erythematosus; MCTD Mixed connective tissue disease; PM: Polymyositis; dsDNA: Double-stranded deoxyribonucleic acid; CENP Centromere protein.
(II) Centro Nacional de Primatas (CENP), Instituto Evandro Chagas (IEC), Secretaria de Vigilancia em Saude (SVS), Ministerio da Saude (MS), Ananindeua, PA, Brasil.
Oregon-based CenterPointe Community Bank (OTCQB: CENP) has reported that it has earned USD155,000, or USD0.14 per diluted share, for its third quarter ending September 30, 2010.