corneal dystrophy of Bowman layer, type 2

(redirected from CDTB)
Also found in: Acronyms.

corneal dystrophy of Bowman layer, type 2

An autosomal dominant (OMIM:602082) form of corneal dystrophy characterised by honeycomb-like, subepithelial corneal opacities with recurrent erosions and loss of vision.

Molecular pathology
Has been linked to defects of TGFBI, which encodes an RGD protein that binds to type-I, -II and -IV collagens and plays a role in cell–collagen interactions. Mutations in TGFBI has been linked to a number of corneal dystrophies:
• Avellino type (OMIM:607541);
• Epithelial basement membrane (OMIM:121820);
• Groenouw type I (OMIM:121900);
• Lattice type I (OMIM:122200);
• Lattice type IIIA (OMIM:608471);
• Reis-Bucklers type (OMIM:608470);
• Thiel-Behnke type (OMIM:602082).
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Regarding the cdt genes, cdtB was present in 121 isolates (81.2%), while cdtA and cdtC were present in 102 (67.1%) and 103 (68.7%) isolates, respectively.
Presence / absence of cdtB in these isolates were confirmed by two different sets of primers, one set (forward5' GTTAAAATCCCCTGCTATCAACCA 3' and reverse- 5' GTTGGCACTTGGAATTTGCAAGGC 3') reported in an earlier study (19) and the other set (forward- 5' GCGTTGATGTAGGAGCTAATCGTG 3' and reverse-5'GGTTGATCGCGTTGAGTTCGTT 3') designed in our laboratory (gene bank accession no DQ882648) using Biosoftware (Primer Premier, PREMIER Biosoft International, Palo Alto, CA, USA).
Both isolates had tcdA, tcdB, and cdtB and had a deletion in tcdC (data not shown).
albertii strains isolated so far contained the cdtB gene encoding the cytolethal distending toxin B subunit (8,9), we examined the presence and subtype of the cdtB gene as described (online Technical Appendix).
A multiplex PCR protocol that amplified the consensus portion of the B subunit of the cytolethal distending toxin gene (cdtB) as described by Toth (16) was modified by using each of the primer pairs (s1/as1 and s2/as2) individually to screen for cdtB in all isolates.
Primers used in study of hospitalized patients with Clostridium difficile infection, Canada, 2004-2008 Sequence (5' Primer [right arrow] 3') Specificity tcd3 TGCAATTATAAAAACATCTTTAAAC tcdC PaLoc negative regulator tcd4 TATATCTAATAAAAGGGAGATTG cdtS-F1 TGGACAGGAAGAATAATTCCTTC cdtB binary toxin subunit B cdtS-R1 TGCAACTAACGGATCTCTTGC E5 CTCAAAACTTTTTAACGAGTG ermB erythromycin/clindamycin resistance E6 CCTCCCGTTAAATAATAGATA GyrAF TTGAAATAGCGGAAGAAATGA gyrA DNA gyrase subunit A GyrAR TTGCAGCTGTAGGGAAATC GyrBF GAAGGTCAAACTAAAACAAA gyrB DNA gyrase subunit B GyrBR GGGCTCCATCTACATCG Table 2.
PCR ribotyping and detection of genes for toxins A (tcdA), B (tcdB), binary toxin (cdtB), and toxin regulator (tcdC) were performed as previously described (4,8,9).
Presence of tcdA, tcdB, cdtB (binary toxin), and deletions in tcdC was determined by PCR (2).
PCR was used to detect cdtB, one of the genes encoding binary toxin.
([double dagger]) Traits that did not show p [less than or equal to] 0.01 but were detected in [greater than or equal to] 1 isolate each include the F7-2, F8, F9, F11, F12, F12, F14, and F15 papA alleles, papC (P fimbriae assembly), papEF (P fimbriae tip pilins), papG alleles I and II (both internal and flanking sequences), afaE8 (variant Dr binding adhesin), gafD (G fimbriae), F17 fimbriae, f1mH (type 1 fimbriae), clpG (adhesin), cdtB (cytolethal distending toxin B), ireA (siderophore receptor), kpsM III (group 3 capsule), K1 and K2 kpsM II variants, cvaC (microcin V), ibeA (invasion of brain endothelium), and rfc (04 lipopolysaccharide biosynthesis).
PCR ribotyping and gene identification for toxins A (tcdA) and B (tcdB), the binding component of CDT (cdtB), and the tcdC gene were performed as previously described (4,10).