CDKN2A


Also found in: Dictionary.

CDKN2A

A gene on chromosome 9p21 that encodes an alternate open reading frame (ARF) product, which acts as a tumour suppressor by binding to MDM2 and blocking its nucleocytoplasmic shuttling by sequestering it in the nucleolus. This inhibits MDM2’s oncogenic activity, which would normally degrade p53, a tumour suppressor protein. CDKN2A also induces G2 arrest and apoptosis, independent of p53, by preventing the activation of cyclin B1/CDC2 complexes.

CDKN2A also binds to:
• BCL6, downregulating BCL6-induced transcriptional repression;
• E2F1 and MYC, blocking their transcriptional activator activity;
• HUWE1, repressing its ubiquitin ligase activity;
• TOP1/TOPOI, stimulating its activity. This complex binds to rRNA gene promoters and may play a role in rRNA transcription and/or maturation.

CDKN2A interacts with:
• COMMD1 and promotes its “Lys63”-linked polyubiquitination;
• NPM1/B23, promoting its polyubiquitination and degradation and inhibiting rRNA processing;
• UBE2I/UBC9, enhacing sumoylation of some of its binding partners (e.g., MDM2 and E2F1).
References in periodicals archive ?
Hypermethylation of the CDKN2A gene promoter is a frequent epigenetic change in younger patients with cervical carcinoma and implies a significant epigenetic role in tumor development in this age group [51].
TABLA I INCIADORES UTILIZADOS EN LA PRUEBA DE PCR PRIMER SECUENCIA Pares de Ta Reconocida Sentido/Antisentido bases CDKN2B GCGTTCGTATTTTGCGGTT 147 60[grados]C CGTACAATAACCGAACGACCGA CDH1 GCGTTTGGTCGCGGGAGTTC 142 53[grados]CC TTCCCTCAAAAATCGTCCCCAC APC TATTGCGGAGTGCGGGTC 108 63[grados]CC TCGACGAACTCCCGACGA CDKN2A TTATTAGAGGGTGGGGCGGATCGC 149 66[grados]CC GACCCCGAACCGCGACCGTAA hMLH1 AGAGTGGATAGTGATTTTTAATGT 130 60[grados]CC ACTCTATAAATTACTAAATCTCTTCA TABLA II ESTADO DE METILACION POR GENES ESTUDIADO Y POR ESTADIO CLINICO Genes Analizados Estadio II Estadio III Estadio IV % TOTAL P15 2(6,66%) 6(20%) 4(13,33%) 23,07% P16 1(3,38%) 2(6,6%) 5(16,66%) 15,39% hMLh1 0 0 4(13,33%) 7,7% CDH1 0 4(13,33%) 7(23,33%) 21,15% APC 2(6,6%) 7(23,33%) 8(26,66%) 32,69%
In a study in cancer-related signalling pathways in EBV-associated GC, genes of cell cycle regulation (IGFBP3, CDKN2A, ID2, HSP70, CCND1, and ID4), DNA repair (BRCA1, TFF1), cell adhesion (ICAM1), angiogenesis (HIF1A), and inflammation (COX2) were found deregulated [200].
Frequent somatic alterations of CDKN2A and NF1 significantly co-occur with PRC2 alteration.
Several studies identified inactivation of tumour suppressors (RB1, TP53, and CDKN2A), activation of oncogenes (NRAS, KRAS), and mutations in epigenetic regulators (TET2, TET1, DNMT3A, IDH1, and IHD2) that are also frequently mutated in AML and myelodysplastic syndromes; furthermore, mutations in the IKAROS family genes and ATM aberrations have been discovered that are commonly found in lymphoid neoplasms [11-15].
UCA1, a direct target of coactivator of AP1 and estrogen receptor [alpha] (CAPER[alpha])/T-box3 (TBX3) repression, sequesters hnRNP I, which suppresses transcription of CDKN2A and destabilizes CDKN2A mRNA [44].
Likewise, a set of hypermethylated gene promoters, for example, FZD7, CDKN2A, RASSFIA, and APC, were able to distinguish nontumor liver tissues from HCC tumors.
There are many proposed theories such as polymorphisms in PPAR2, IGF2BP2, CDKL1 and CDKN2a in the quest to find a link between genetic factors and GDM.7 Many studies have linked T2DM with polymorphisms in KCNQ1 gene.16,11,13,19 but few with GDM.
(10) Although common etiological factors for both RCC and melanoma are not well-established, there are several possible links between these cancers, including: 1) exposure to shared environmental risk factors, such as obesity; (11) 2) shared genetic abnormalities, such as a common missense mutation in microphthalmia-associated transcription factor, (12) alterations in the CDKN2A gene encoding p16INK4a, (13) and increased association of familial RCC and melanoma; (14) 3) alterations in the MAPK pathway; (15) 4) alterations in cell-mediated immunity; (16) and 5) increased medical surveillance leading to increased incidental detection of RCC.
Por ejemplo, se ha reportado que la hipermetilacion de CDKN2A es un evento que ocurre muy temprano (fase premaligna); mientras que la metilacion de los genes RASSF1A, APC, ESR1, ABCB1, MT1G y HOXC9 esta asociada con NSCLC estadio I.
A gene called CDKN2A is more active in sunexposed facial skin than in samples taken from the buttocks.
W toku badan ustalono takze, ze istotne w rozwoju czerniaka sa rowniez oksydacyjne uszkodzenia DNA, ktore prowadza do wystapienia mutacji w genie supresorowym p16INK4A (CDKN2A) (cyclin-dependent kinase inhibitor 2A INK4A), genie kodujacym cyklinozalezna kinaze 4 (cyclin-dependent kinase 4--CDK4) oraz mutacji aktywujacych kaskade przekazywania sygnalu w onkogenach Ras i BRAF (proto-oncogene B-Raf) [41].