Also found in: Acronyms.


A gene on chromosome 10q21.1 that encodes a Ser/Thr protein kinase family, a catalytic subunit of the conserved complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins associate with CDK1, controlling its activity by cyclin accumulation and destruction through the cell cycle; phosphorylation and dephosphorylation of CDK1 play important regulatory roles in controlling the cell cycle.
Mentioned in ?
References in periodicals archive ?
3 26 SYBR_CAPDH_rev TTGATTTTGGAGGGATCTCG 20 CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and S-phase expressed 1; HIST, histone cluster; ITPR1, inositol 1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis viral oncogene homolog; RHOJ, ras homolog gene family, member J; SRGAP3, SLIT-ROBO Rho GIPase activating protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.
Resveratrol significantly influenced the transcription of genes that are involved in DNA replication (down-regulation of HIST2H3D, HIST1H3J, CDK1 and TOP2A; Table 2).
Both methods show a downregulation of DNA replication and p53 pathway-involved genes HIST2H3D, HIST1H3J, CDK1, TOP2, CDK1, CDK2, CCNB1 and GTSE, as well as CCNA2 and RHOJ.
This cyclin binds and activates CDK1 or CDK2 kinases and thus promotes both cell cycle G1/S and G2/M transitions (http://www.
69 MWold Change CDK1 CDK2 SRGAP3 GTSE1 ITPR1 Res Gene 3.
MJ-29 inhibits tubulin polymerization, induces mitotic arrest and triggers apoptosis via CDK1 -mediated Bcl-2 phosphorylation in human leukemia U937 cells.
Antibodies against CDK1, CDK2, CDK4, cyclin A, cyclin B, cyclin D, cyclin E, p[21.
Of the proteins regulating G2/M phase, daidzein decreased CDK1 expression by 28.
It also significantly decreased the expression of cyclins A and B, which combine with CDK1 to control the G2/M phase (Fig.
The down-regulation of CDK1 (Cdc2) by daidzein might be the main cause of the G/M phase arrest.