CCR2


Also found in: Acronyms, Wikipedia.

CCR2

A gene on chromosome 3p21.31 that encodes a receptor for monocyte chemoattractant protein-1 (MCP-1), a chemokine that mediates monocyte chemotaxis through agonist-dependent calcium mobilisation and inhibition of adenylyl cyclase. MCP-1 plays a role in monocyte infiltration in inflammatory responses to rheumatoid arthritis and tumours.
References in periodicals archive ?
The researchers found that a compound that inhibits the CCR2 protein could block the bone marrow's macrophages from entering the heart.
Interestingly, levels of MCP-1 and CCR2 returned to baseline or lower by 16 weeks in mice exhibiting movement-provoked pain behaviors.
Allele and genotype frequencies of CCR2 V64I (G/A), MCP-1 -2518 A/G, SDF-1[alpha] 3'UTR G/A and DC-SIGN exon 4 repeat polymorphisms among different study groups are presented in Tables II and III.
Genetic polymorphism of chemokines receptors CCR2 and CCR5 in Swedish cervical cancer patients.
development, manufacture and marketing of novel oral CCR2 antagonists.
Also in another study investigators were able to correctly classify 70% of LTNPs and 81% of progressors based on parameters that looked at CCR5, CCR2, SDF-1 (a molecule that binds to CXCR4), and HLA genotypic information (Blood, 93:3, p.
Patients with a mutation in either CCR2 and CCR5 - another chemoattractant receptor - were found to be "long-term survivors," defined here as not progressing to AIDS after 16 years or more.
The CCR2 gene sits next to its cousin CCR5 on chromosome 3.
Cenicriviroc (CVC) is a novel, oral, once-daily, fixed-dose combinable, dual inhibitor of chemokine receptors CCR5 and CCR2 being developed for the treatment of HIV-1 infection.
Genbank ID Gene Forward primer Reverse primer name NM_024330 SLC27A3 AGAACTTGCCACCTTATGCC CTCATTTGCCATCCGAACTT NM_024330 FATP-3 CAGAGACCTTCAAACAGCAGAAAGT CAGAACGTACAGTGGGTCAGACA NM_004561 OVOL1 ACAGACCCCCAGAGCAGAG GACTGTCCCCAAGGGTCAC NM_000647 CCR2 GTGTGTGGAGGTCCAGGAGT CAACCCAGCTGGAGTCTCTC NM_018098 ECT2 GCGTTTTCAAGATCTAGCATGTG CAATTTTCCCATGGTCTTATCC NM_000418 IL-4Ra GAC CTG GAG CAA CCC GTA CAT AGC ACA ACA GGC AGA TC CG NM_017414 USP18 CAGACCCTGACAATCCACCT AGCTCATACTGCCCTCCAGA NM_000452 SLC10A2 ACGCAGCTATGTTCCACCATC GCGGGAAGGTGAATACGACA NM_003959 H1P1R AGCCTCCGACATGCTGTACT GTCGTCCTTCACAGACCCAT NM_138285 NUP35 CTACTCCTGGAACAGGGCAA TCCGAGCCTGCAGTTTAGAT NM_002046.
A critical role of CCR2 (chemokine [C-C motif] receptor-2), a MCP-1 receptor on monocytes, has been also seen in hypertensives (32).
The company's lead internal compounds include INCB3284, a proprietary oral CCR2 antagonist that is in Phase II development for a number of chronic inflammatory conditions, and INCB7839, a proprietary, oral sheddase inhibitor that is in Phase I development as a potential treatment for solid cancers.