CCR2


Also found in: Acronyms, Wikipedia.

CCR2

A gene on chromosome 3p21.31 that encodes a receptor for monocyte chemoattractant protein-1 (MCP-1), a chemokine that mediates monocyte chemotaxis through agonist-dependent calcium mobilisation and inhibition of adenylyl cyclase. MCP-1 plays a role in monocyte infiltration in inflammatory responses to rheumatoid arthritis and tumours.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Huber et al., "CCR2 modulates inflammatory and metabolic effects of high-fat feeding," The Journal of Clinical Investigation, vol.
Simultaneous activation of nucleotide-binding oligimerization domain 1 (NOD1) and cholecystokinin receptor (CCKR) leads to a robust production of C-C motif chemokine ligand 2 (CCL2) through activation of nuclear factor-[kappa]B (NF-[kappa]B) and signal transduction and activator of transcription 3 (Stat3), which mediates migration of C-C chemokine receptor type 2 (CCR2)-expressing inflammatory myeloid cells into the pancreas.
Gene Forward (5' [right arrow] 3') Cxcr2 atccaccttgaattctcccatc Il6ra cctctgacttccatttctgct Cxcr1 tcccgtgatatttccaaattctttc Ccr3 ggtgcccactcatattcatagg Ccr5 gtgctgacataccataatcgatg Ccr1 aggaactggtcaggaataatagc Gpr75 tcaggatctcagctcacaga Ccr2 actgaggtaacatattattgtcttcca Cx3cr1 cacaatgtcgcccaaataacag Cyclophilin tggagagcaccaagacagaca Gene Reverse (5' [right arrow] 3') Product length (bp) Cxcr2 gcctcactttcttccagttca 145 Il6ra caagaatcctcgtccatgtcc 118 Cxcr1 tcccgcacacaaggaac 120 Ccr3 ctactggactcataaaggacttagc 125 Ccr5 tgtcttcatgttagatttgtacagc 147 Ccr1 caaaggcccagaaacaaagtc 125 Gpr75 agatagggtcactactgcga 102 Ccr2 gagccatacctgtaaatgcca 148 Cx3cr1 tcccttcccatctgctca 112 Cyclophilin tgccggagtcgacaatgat 66 Table 2: Cytokines/chemokines receptors name and its ligands.
In this study, our aim was to assess whether there were genetically driven differences between the immune responses of healthy people and those with PD, specifically in terms of polymorphisms in chemokines and their receptor genes IL-8, MCP-1, RANTES, CCR2, and CCR5.
No changes in insulin sensitivity blood pressure or insulin sensitivity [100] Insulin sensitivity, Improved insulin inflammatory biomarkers, sensitivity but no changes and adiposity in adiposity or inflammatory biomarkers [98] Body weight, blood Decreased CRP, IL-6, IL- pressure, glucose, lipid 12, and LPS concentrations profile, and inflammatory and decreased expression parameters of MMD and CCR2 in monocytes.
Furuichi et al., "Blockade of CCR2 ameliorates progressive fibrosis in kidney," The American Journal of Pathology, vol.
Its lead product candidate, cenicriviroc (CVC), is a first-in-class immunomodulator and dual inhibitor of CCR2 and CCR5 in late-stage development for the treatment of NASH, a serious liver disease that can progress to cirrhosis, liver cancer and liver failure.
CNTX-6970 is a novel, potent and selective cytokine CCR2 antagonist with a unique analgesic profile.
As mentioned above, CS-induced inflammatory process promotes the release of several chemotactic factors, including MCP-1, which acts on CC-chemokine receptor 2 (CCR2) to attract monocytes, and KC and IL-8, which act on CCR2 to attract neutrophils and macrophages (Barnes 2009).
Then, the cells were stained with antibodies to CD34 (Santa Cruz Biotechnology, USA), VEGFR-1 (Sigma-Aldrich, USA), CD115, CD117 (Abcam, USA), CD14, CCR2 (Santa Cruz Biotechnology), and CD90, CD44, STRO-1, OCT3/4, and Nanog, all from Abcam, at a concentration of 1 [micro]g/mL at 4[degrees]C for 30 min.