CCNB1

CCNB1

A gene on chromosome 5q12 that encodes cyclin B1, which is essential for controlling the cell cycle at the G2/M transition. Cyclin B1 interacts with the CDC2 protein kinase to form a serine/threonine kinase holoenzyme complex, the maturation promoting factor, and interacts with RALBP1 and CDC2 during mitosis to form an endocytotic complex during interphase.
References in periodicals archive ?
Although the levels of most genes in untreated 24 h-aged IVM and 10 |mM rapamycin-treated 24 h-aged IVM oocytes were lower than those in control IVM oocytes, rapamycin-treated aged IVM oocytes expressed higher levels of MOS, BMP15, GDF9, and CCNB1 (p < 0.
GAPDH AF017079 F :GGGCATGAACCATGAGAAGT R:AAGCAGGGATGATGTTCTGG MOS NM_001113219 F:TGGGAAGAAACTGGAGGACA R:TTCGGGTCAGCCCAGGTTCA BMP15 NM_001005155 F:CCCTCGGGTACTACACTATG R:GGCTGGGCAATCATATCC GDF9 AY_626786 F:GAGCTCAGGACACTCTAAGCT R:CTTCTCGTGGATGATGTTCTG CCNB1 NM_001170768.
Other upregulated genes were related to cell proliferation and its control, such as cyclin-dependent kinase gene CDK1/CDC2; cyclin genes CCNA2, CCNB1, CCNB2, and CCNL2; the DLG7 component of the mitotic apparatus; the gene encoding the checkpoint kinase involved in response to DNA damage, CHEK1/CHK1; and BUB1 and MAD2L1, components of the spindle checkpoint.
These 11 genes were Gbx2, KI67, CCNB1, BUB1, KNTC2, USP22, HCFC1, RNF2, ANK3, FGFR2, and CES1.
Nine of the Oncotype DX gene primer sets (for BAG1, CCNB1, SCUBE2, GRB7, ERBB2, MK167, MYBL2, PGR, and TFRC genes) span intron sequences and so do not detect genomic DNA; the 12 remaining Oncotype DX genes were tested for sensitivity to genomic DNA added into an FPET RNA pool.
Pattern 8 was composed of 901 genes that were repressed moderately at 6 hr but highly repressed at 24 hr, including many genes whose products participate in various DNA metabolic events during the cell division cycle, such as ASK, CCNA2, CCNB1, CCNB2, CDK2, CDC2, CDC6, CDC45L, CDC7L, MCMs, RFC subunits, and TOP2A (Mendez and Stillman 2000; Stillman 1996).
The relative expression of CDK1, CDK2, CCNB1, GTSE1, ITPR1, c-MYC, SRGAP3, HIST2H3D, HIST] H3J, TOP2A, CCNA2 and RHOJ was determined.
While the majority of these 16 genes were found to be estrogen receptor-related (ESR1, PGR, BCL2, SCUBE2) and proliferation-related (Ki67, STK15, Survivin, CCNB1, MYBL2), some genes did not belong to these 2 categories (HER2, GRB7, MMP11, CTSL2, GSTM1, CD68, BACG1).
CCNB1, PLK1) are coordinately induced and reach maximal expression levels between 8 and 24 hr (Figure 6B), consistent with the timing of the histologic changes observed in Figure 6A.
Several genes in the set of 11 confirmed genes are known to be up-regulated or involved in other cancers: CCNB1 (cyclin B1) (16,17), AURKB (aurora B kinase) (18), SPINT2 (serine protease inhibitor 2) (19), OAZ1 (ornithine decarboxylase antizyme 1) (20), and HPV16 E7 (the E7 protein of human papillomavirus 16) (21).