CCNA2

CCNA2

A gene on chromosome 4q25-q31 that encodes cyclin A2, which binds and activates CDC2 or CDK2 kinases, thus promoting both cell cycle G1/S and G2/M transitions.
Mentioned in ?
References in periodicals archive ?
The relative expression of CDK1, CDK2, CCNB1, GTSE1, ITPR1, c-MYC, SRGAP3, HIST2H3D, HIST] H3J, TOP2A, CCNA2 and RHOJ was determined.
3 26 SYBR_CAPDH_rev TTGATTTTGGAGGGATCTCG 20 CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and S-phase expressed 1; HIST, histone cluster; ITPR1, inositol 1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis viral oncogene homolog; RHOJ, ras homolog gene family, member J; SRGAP3, SLIT-ROBO Rho GIPase activating protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.
Both methods show a downregulation of DNA replication and p53 pathway-involved genes HIST2H3D, HIST1H3J, CDK1, TOP2, CDK1, CDK2, CCNB1 and GTSE, as well as CCNA2 and RHOJ.
CCNA2 belongs to the highly conserved cyclin family, which function as regulators of CDK kinases.
Other upregulated genes were related to cell proliferation and its control, such as cyclin-dependent kinase gene CDK1/CDC2; cyclin genes CCNA2, CCNB1, CCNB2, and CCNL2; the DLG7 component of the mitotic apparatus; the gene encoding the checkpoint kinase involved in response to DNA damage, CHEK1/CHK1; and BUB1 and MAD2L1, components of the spindle checkpoint.
Pattern 8 was composed of 901 genes that were repressed moderately at 6 hr but highly repressed at 24 hr, including many genes whose products participate in various DNA metabolic events during the cell division cycle, such as ASK, CCNA2, CCNB1, CCNB2, CDK2, CDC2, CDC6, CDC45L, CDC7L, MCMs, RFC subunits, and TOP2A (Mendez and Stillman 2000; Stillman 1996).