CCL1


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.

CCL1

A gene on chromosome 17q12 that encodes a protein structurally related to the CXC subfamily of cytokines, which are characterised by two cysteines separated by a single amino acid. CCL1 is secreted by activated T cells and is chemotactic for monocytes but not neutrophils; it binds to chemokine receptor CCR8.
Mentioned in ?
References in periodicals archive ?
In cutaneous post-capillary venules, T cell rolling, integrin activation and cell adhesion are regulated by PSGL-1-selectins interactions, chemokines including CCL1 and CCL17, and LFA1-ICAM-1 interactions, respectively.
CXCR3 and CCL1 genes selected for the study were amplified from cDNA of macrophages (Fig.
size (bp) CXCR3 2 F: GAAAGCAGTGTGGACATAGCCA 101 R: CGGAACTTGACACCCACAAAG CCL1 19 F: AGGCTGGATCTGCTCCCAAAT 152 R: GGTGATGTGTGCAAGTTCACCA GAPDH 5 F: CTCCCAACGTGTCTGTTGTG 222 R: TGAGCTTGACAAAGTGGTCG
Then the cytokines TNF-a IL6 (M1 markers) and IL10 CCL1 (M2 mar-kers) secreted by BMDM were detected using ELISA.
Immune response genes selected for the study (TLR2, NFKB1, IL2, IL16, TNF, IFNG, CXCR3, CCL1, CD81, CD84, RPS6KB2, STK17B, PRKCB1, MCL1, EEF1G, NFATC4, EEF1 and IER5) were amplified from cDNA of PBMCs (Fig.
Seven genes (IL16, CCL1, EEF1G, CD84, MCL1, NFATC4 and IER-5) did not reveal any significant difference between Tharparkar and Vrindavani.
Thrombospondin-1 Fragment (THBS1), Gallus gallus vkit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), Gallus gallus fibroblast growth factor 10 (FGF10) and Gallus gallus chemokine (C-C motif) ligand 1 (CCL1).
Signal transduction TSC2, SOCS3 mTOR, SHIP1, SOCS1, molecules: Notch PDL-1, CD163, CD204, CD206, CD301, IRAK- M Ron, TRAF-2, Rock2 Soluble mediators IL-12, TNF-a, Gas6 IL-1, IL-4, IL-6, (cytokines, growth CXCL9, CXCL10, IL-10, L-33, IL-34, factors): CXCL11 TGF-[alpha], CSF-1 Ym1, Fizz1, SDF-1, WNT5A, WNT7B, BMP6 CCL1, CCL2, CCL17, CCL18, CCL22, CCL24, CXCL8, CXCL12 Transcription NF-kB p65/p50 NF-[kappa]B p50- factors: STAT1 p50, STAT3, STAT6, PPAR[gamma] RORC1- ROR[gamma], HIF-1, HIF-2, IRF4 miRNAs: miR-155, miR-33 miR-146a, miRNA let 7b, miR-223
In addition, chemokines such as CCL1, CCL2, CCL3, and CCL4 were also detected in evolving brain abscesses that most probably contribute to the influx of lymphocytes and monocytes and the establishment of the adaptive immune response [92].