bromine

(redirected from Br2)
Also found in: Dictionary, Thesaurus, Acronyms, Encyclopedia.

bromine

 (Br) [bro´mēn]
a chemical element, atomic number 35, atomic weight 79.909. (See Appendix 6.)

bro·mine (Br),

(brō'mēn, -min),
A nonmetallic, reddish, volatile, liquid element; atomic no. 35, atomic wt. 79.904; valences 1-7, inclusive; it unites with hydrogen to form hydrobromic acid, and this reacts with many metals to form bromides, some of which are used in medicine.
[Fr. brome, bromine, fr. G. bromos, stench]

bromine

Chemistry
A halide element (atomic number 35, atomic weight 79.9), a deep reddish-brown liquid that emits a brownish vapour at room temperature, present in minute quantities in sea water and in some saline springs. 

Medical history
A bromide compound commonly used as a sedative in the 19th century.

bro·mine

(Br) (brō'mēn)
A nonmetallic, reddish, volatile, liquid element; atomic no. 35, atomic wt. 79.904; valences 1-7, inclusive; it unites with hydrogen to form hydrobromic acid, and this reacts with many metals to form bromides, some of which are used in medicine.
[Fr. brome, bromine, fr. G. bromos, stench]

bro·mine

(Br) (brō'mēn)
A nonmetallic, reddish, volatile, liquid element; unites with hydrogen to form hydrobromic acid, and this reacts with many metals to form bromides, some of which are used in medicine.
[Fr. brome, bromine, fr. G. bromos, stench]
References in periodicals archive ?
(38,48) In addition, the results for the role of ACE genotypes in systemic lupus erythematosus and asthma are contradictory; (49-53) while the data on the role of BR2 and BR1 polymorphisms in asthma and inflammatory bowel disease are limited and need further confirmation.
Very good results (higher than 95%) for the dye removal percentage were obtained at low concentrations (Table 3), but even at high concentrations the removal percentage is high in case of BR2 (>93%) and higher than 50% for NB and ChS dyes.
The Br2 (0.8 mL, 2.42 g, 15 mmol, 1 eq) was added as drops to the solution of ketone (15.0 mmol, 1 eq) in CHCl3 (20 mL) acidified with H2SO4 (4.5 mmol, 0.44 g, 0.2 mL).
The effects of single inoculation (Br 1, Br 2 and G) and that of the double inoculation (Br1 and Br2 + G + G) are highly significant compared to the control.
[19] study PV -1.910 -1.881 -1.879 BR1 3.752 4.053 3.728 BR2 0.302 0.313 0.301 BL1 2.146 2.086 2.136 TL1 2.297 2.183 2.273 TABLE 5: Comparison of numerical results by oblique hydraulic jump.
Level 3--Sequencing of factors (biological, psychological and social) with biological focus/centering (Categories: S3, BRI BR2, BR5)
The Outfitter Fleece Pant (BR2) has an elastic waist with draw cord and stirrup straps at the feet for no-ride-up fit under bibs.
City, Reactor Age Country Province Facility Name (Years) Canada Rolphton, NRU Chalk 52 Ontario River The Netherlands Petten HFR 47 Belgium Mol BR2 47 France Saclay OSIRIS 42 South Africa Pelindaba SAFARI 43 Australia Sydney OPAL 2 % World Supply Power Output Country of Moly (Megawatts) Canada 33% 135 The Netherlands 33% 45 Belgium 10% 100 France 8% 70 South Africa 3% 20 Australia N/A 20
Then Br2 was added to one of the solutions (in this solution CHBr3 was not added), and in the other solution CHBr3 was added without adding the Br2.
Table 1: Primers and PCR conditions Gene Amplicon Primers used [T.sub.m] Product ([degrees] size (bp) C) TP53 Exon 7 F: CTTGCCACAGGTCTCCCCAA 62 237 R: AGGGGTCAGCGGCAAGCAGA K Exon 1 F: ATGACTGAATATAAACTTGTGGTAG 56 115 Ras R: AATCCTCTATTGTTGGATCATATTC Table 2: Tumor tissue information Tissue/Sample Cancer type Storage time Histopathology X01 Adenocarcinoma 5 months Grade II A X02 Adenocarcinoma 5 months Grade III B BR1 Adenocarcinoma 8 months Grade II B BR2 Adenocarcinoma 8 months Grade IV BT1 Squamous Cell Carcinoma 2 months Grade II A BT2 Squamous Cell Carcinoma 2 months Grade II B Table 3: Yield and purity of DNA extracted by different methods.
Loss on Ignition 5.44% Table 3: Mix Proportion for M 30 Grade Concrete Mixtures Mix Designation BC BR1 BR2 BR3 Ricehusk aSK Present (%) 0 5 10 15 w/b rati 0.43 0.43 0.43 0.43 Cement (Kg/[m.sup.3] 420 399 378 357 Ricehusk ash (Kg/[m.sup.3] 0 21 42 63 Sand (Kg/[m.sup.3] 621 582 542 503 Coarse aggregate (Kg/[m.sup.3] 1108 1108.
The cultivars used were 'BR2', 'BRS180', 'BRS195', 'EMBRAPA127', 'FM404', 'GIMPEL', 'MN684', 'MN698', and 'SCARLETT'.