BIRC3


Also found in: Acronyms.

BIRC3

A gene on chromosome 11q22 that belongs to the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. BIRC3 acts by binding to tumour necrosis factor receptor-associated factors TRAF1 and TRAF2, interfering with activation of ICE-like proteases.
Mentioned in ?
References in periodicals archive ?
Antiapoptotic processes are activated 20 min after irradiation or the addition of cfDNAox and cfDNAoxR fragments to the medium, and the levels of antiapoptotic genes BCL2, BCL2A1 (Bfl-1/A1), BCL2L1 (BCL-X), BIRC2 (c-IAP1), and BIRC3 (c-IAP2) increase 1.5-2.5-fold (Table 3).
Content of 8-oxodG per [10.sup.6] nucleotides gDNA <0.01 cfDNAox 400 cfDNAoxR 200 Table 3: Dependence of the changes in the levels of antiapoptotic genes BCL2, BCL2A1 (Bfl-1-A1), BCL2L1 (BCL-X), BIRC2 (c-IAP1), and BIRC3 (c-IAP2) and proapoptotic BAX expression in irradiated and exposed to cfDNAox, cfDNAoxR, and gDNA in MSCs on the time after exposure (RT-PCR).
CBP mediates NF-kappaB-dependent histone acetylation and estrogen receptor recruitment to an estrogen response element in the BIRC3 promoter.
Primers NCBI ID Primer sequences S: 5'TTTCTCATGGCTGTCCTTCAG Bcl2 NM_000633.2 GGT 3' A: 5'AGGTCTGGCTTCATACCACAG GTT 3' S: 5'GTCTGCAACATGGAAGGTA HIF1A NM_001530.3 TTG 3' A: 5'GCAGGTCATAGGTGGTTTCT 3' S: 5'GAAGATTGAGCGGCCTGTAA NF-[kappa]B NM_002502.5 3' A: 5'TGTCTTCCACCAGAGGGTA ATA 3' S: 5'CAAGCCAGTTACCCTCATC BIRC3 NM_001165.4 TAC 3' A: 5'CTGAATGGTCTTCTCCAGG TTC 3' Table 2: List of differentially expressed genes in MCF7 cells exposed to hUCMSC-CM.
In parallel, the level of expression of the three other antiapoptotic genes, BCL2L1, BIRC2, and BIRC3, remains the same or becomes increased.
(c) (qRT-PCR): changes in the levels of mRNAs encoding BCL2A1, BCL2, BCL2L1, BIRC2, BIRC3, and BAX in HELFs.
Many other genes are commonly mutated in CLL, including the following: NOTCH1; XPO1 (exportin 1); MYD88; KLH6 (Kelch-like 6); TP53; TGM; BIRC3; PLEKHG5; ATM; SF3B1 (splicing factor 3, B1 unit); ZMYM3; MAPK1; FBXW7; and DDX3X.
Consistent with 15 nM LBH589 being a sublethal concentration based on the absence of morphological cell apoptotic features, no detectable loss of cell number, and similar proportion of early apoptotic cells to DMSO control following 48 hours culture, our gene expression data demonstrated increased expression of antiapoptotic genes (BIRC3, BCL2L2, and CFLAR) and decreased expression of proapoptotic genes (CASP3, BCL2L11, CARD8, CASP6, BNIP1, BCLAF1, CASP2, and APAF1) following LBH589 treatment (Figure 3).
Alteration of BIRC3 and multiple other NF-kB pathway genes in splenic marginal zone lymphoma.
(53-57) For example, novel candidate oncogenes include SMURF1 on 7q21, FGFR1 on 8p12, BIRC2 and BIRC3 on 11q22, and PAK4 on 19q13, whereas novel candidate tumor suppressor genes include TUSC3 on 8p22 and FEZ1 on 8p23.