BIRC2

BIRC2

A gene on chromosome 11q22 that encodes a protein which inhibits apoptosis by binding to tumour necrosis factor-receptor-associated factors TRAF1 and TRAF2, interfering with activation of ICE-like proteases.
Mentioned in ?
References in periodicals archive ?
BIRC2 (baculoviral IAP repeat containing) and BIRC3 are also known mediators of apoptosis suppression which also interact with the TNF-mediated activation of caspases [46].
Module 3 possessed the largest gene size, including TNF (ego gene), DCN, PRTN3, BIRC2, ARGN and THBS1, and the 5 genes made up 5 interactions.
BIRC2 (GAATCTGGTTTCAGCTAGTCTGG; GGTGG GAGATAATGAATGTGCAA);
Other important factors that decide the cell fate are apoptotic protein inhibitors like BIRC2 and BIRC3 that inhibit the activity of caspase-3, caspase-7, and caspase-9 [42].
In addition, CCNE2, PIK3CB, ITGAV, RB1, and BIRC2 involved in cancer pathway were also affected.
Chromosome 11q deletion is observed in 7% of myeloma cases and harbours the tumour suppressor genes BIRC2 and BIRC3 [57].
(53-57) For example, novel candidate oncogenes include SMURF1 on 7q21, FGFR1 on 8p12, BIRC2 and BIRC3 on 11q22, and PAK4 on 19q13, whereas novel candidate tumor suppressor genes include TUSC3 on 8p22 and FEZ1 on 8p23.
433 hypermethylated genes were discovered such as Gpr4, Dgcr8, Zeb2, Dixdc1, Sox2, Shh, Lrfn3, Det1, Shox2, Abracl, Trdn, Irx2, Pabpc6, Sbk1, and Peg3.134 hypomethylated genes which included Gpr126, Birc2, Sepw1, Irgq, Atp5sl, Hipk4, Ttc9b, Tulp2, Bex1, Mex3b, Ctsc, Gucy2d, Rrm1, Fam160a2, and Cdkn1c were revealed.
In addition to validating the MeDIP analysis results, qRT-PCR was used to quantify parts of mRNAs of corresponding methylated genes in ASCs compared with NSCs, such as 5 differentially hypermethylated genes (Dgcr8, Zeb2, Dixdc1, Sox2, and Shh) and 2 differentially hypomethylated genes (Gpr126, Birc2), resulting in the fact that they were closely related with repairment of peripheral nerve injury after searching PubMed.
Gao et al., "Lipopolysaccharide induces autophagy through BIRC2 in human umbilical vein endothelial cells," Journal of Cellular Physiology, vol.