amphiregulin


Also found in: Dictionary, Acronyms, Encyclopedia, Wikipedia.

amphiregulin

A 84-residue bifunctional cell growth-modulating glycoprotein encoded by AREG on chromosome 4q13-q21, which inhibits the growth of certain tumours (e.g., epidermal cancer) and stimulates the proliferation of fibroblasts. The carboxy-terminal half of amphiregulin has considerable structural homology with epidermal growth factor and binds to its receptor.
Mentioned in ?
References in periodicals archive ?
Abbreviations: Areg: amphiregulin; DCs: dendritic cells; ECs: epithelial cell; IL: interleukin; LTD4: leukotriene D4; PGD2: prostaglandin D2; TGF-[beta]1: transforming growth factor beta; Th2: T helper type 2 cell; TSLP: thymic stromal lymphopoietin.
For detection of AREG, the Human Amphiregulin ELISA Kit (Sigma-Aldrich, Darmstadt, Germany) was used according to the manufacturer's protocol.
Amphiregulin (AREG), the most differentially expressed gene, codes for a glycoprotein, that is, a member of the epidermal growth factor family (EGF), the members of which are ligands that can bind EGFR.
In addition, the expression of ligands (epiregulin and amphiregulin) and PTEN, an important downstream regulator of the EGFR, may have the potential to contribute to response prediction among patients receiving EGFR inhibitors.
Yu et al., "YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway," Nature Cell Biology, vol.
The discovery that both estrogen and progesterone must be present for the increased production of the protein amphiregulin, which binds to mammary cells and promotes cell growth, could lead to new treatment methods for the disease, said Sandra Haslam, director of Michigan State University's Breast Cancer and the Environment Research Center and lead researcher on the project.
Real-time PCR was performed to assess relative transcript levels of Cyp1a1, Cyp1a2, Cyp 1b1, Areg (amphiregulin), Ereg (epiregulin), Egf (epidermal growth factor), RacI (Ras related C3 botulinum substrate l),Tgfb (transforming growth factor beta), Bax (BCL-2 associate X protein), Ccndl (cyclin dl), Mki67 (antigen identified by monoclonal antibody Ki 67), Igft (insulin-like growth factor 1), Fgf2 (fibroblast growth factor 2), Ahr, Egfr (epidermal growth factor receptor), and Esrl (estrogen receptor, alpha) using Assays-on-Demand (Applied Biosystems), with Gusb (glucuronidase, beta) and Actb (actin, beta) as endogenous controls in hepatic and mammary tissues, respectively.
Recent studies have found that these macrophages generate a high level of amphiregulin [44, 45], a ligand of epithelial growth factor receptor, which has been found to protect the epithelial barrier and inhibit the gene expression of proinflammatory cytokines in LPS-induced ALI and ventilator-induced lung injury models [44, 45].
(40) Other EGFR ligands besides EGF have been shown to stimulate invasion, including transforming growth factor [alpha] (TGF[alpha]), betacellulin, heparin-binding EGF-like growth factor (HB-EGF), and amphiregulin (AREG).
The primers used were Msx2, forward: ggaagaccagatggaccaga, and reverse: tctgtatcaagtggccctgtc; amphiregulin, forward: aaggaggcttcgacaagaaa, and reverse: atccgaaagctccacttcct; and ribosomal protein L19 (a housekeeping gene), forward: atcgccaatgccaactcc, and reverse: tcatccttctcatccaggtca.
Results from gene expression profiles have shown that tumours that express high levels of the EGFR ligands epiregulin (EREG) and amphiregulin (AREG) are more likely to have disease control with cetuximab (EREG, P=0.000015; AREG, P=0.000025).