Accession Number

Also found in: Dictionary, Acronyms, Wikipedia.

Accession Number

Bioinformatics A unique alphanumeric character set which is assigned to each entry in a database to unambiguously identify that particular record. An accession number is given to a nucleic acid sequence when submitted to a DNA repository—e.g., GenBank, EMBL, DDBJ, SWISS-PROT.
Examples MGI accession IDs, GenBank accession IDs, MedLine accession IDs 
Lab medicine A unique alphanumeric character set which is assigned to each specimen processed in a laboratory and which is generally of lesser importance than the patient information, except in the case of timed specimens.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
In the primary PCR reaction, the primers used were the Kit specific forward primer WP-1 (that will anneal with the adaptor sequence); and the HSPA6 reverse primer; SP1, (5' CTAGGATCTCTACCCGGCCGTGCTG 3') that corresponds to nucleotide coordinates 206-230 in the HSPA6 gene (Accession number HQ214118).
Use of a laboratory information system (LIS) to generate unique accession numbers is general practice within the pathology laboratory, and the panel acknowledges that whenever possible all specimens should be assigned an accession number prior to evaluation; however, not all laboratories have an LIS portal accessible at the site of the intraprocedural consultation.
In addition to this, the data can be accessed through the DENVirDB accession number. It also has sequence retrival option to view only the sequences in FASTA format.
PGPR2 strain encoded a LysR family transcriptional regulator (909 bp; Genbank accession number ASQO01000026.1, regions 2019 : 1111), which showed maximum homology with a LysR family regulator from Achromobacter xylosoxidans (68% identity) in BlastP analysis.
2- Bos taurus--GB: Bos taurus [13], Accession Number: AF517824, Identities = 562/566 (99.9%), Gaps = 2/566 (0.3%), Query coverage = 99.0%.
Abstract from: OVID Technologies: PsychINFO Accession number: 2001-05207-005.
M-0044-41 GP-801 636697 M-0044-50 GP-802 636698 M-0044-64 GP-803 636699 M-0044-81 GP-804 636700 M-0044-93 GP-805 636701 M-0044-149 GP-806 636702 M-0044-171 GP-807 636703 M-0044-173 GP-808 636704 M-0044-178 GP-809 636705 M-0044-209 GP-810 636706 M-0044-219 GP-811 636707 M-0044-221 GP-812 636708 M-0044-241 GP-813 636709 M-0044-338 GP-814 636710 M-0044-347 GP-815 636711 M-0044-620 GP-816 636712 M-0044-636 GP-817 636713 M-0044-725 GP-818 636714 M-0044-763 GP-819 636715 M-0044-764 GP-820 636716 M-0044-790 GP-821 636717 ([dagger]) The last set of digits corresponds to the primitive Texas (T-) accession number, denoting the recurrent parent.
Throughout the Visible Storage/Study Center, select objects will be highlighted with in-depth information on wall labels, but most works will be identified only by the museum identifying accession number. This number will be the key to locating information about the object in an online catalog by using one of the several computers in the facility.
Lexis-Nexis Data Base, Roper Center, Accession number: 0097009 for July 1963 Survey; Lexis-Nexis Data Base, Roper Center, Accession number: 0089788 for July 1972 Survey.
The 587-bp consensus sequence (Genbank accession number AY582746) obtained from four sequencing runs on the DNA extracted in Tampa from the Chilean carcass was 100% identical to the mitochondrial nad2 gene sequence of P.
For availability and ordering information, contact the NIC Information Center at 800-877-1461 and reference accession number 018017.