ACAN


Also found in: Acronyms, Wikipedia.

ACAN

A gene on chromosome 15q26.1 that encodes an aggrecan/versican proteoglycan, which is an integral part of the extracellular matrix in cartilage, where it provides compressive resistance.

Molecular pathology
ACAN mutations occur in skeletal dysplasia and spinal degeneration.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
The list of primers used in RT-PCR Gene Sequences COL1A1 5'-CCACGCATGAGCGGACGCTAA-3' 5'-ATTGGTGGGATGTC TTCGTCTTGG-3' COL2A1 5'-GTGTGGAAGCCGGAGCCCTG-3' 5'-GGTCCTGGTTGCCCACTGGC-3' ON ATGAGGGCCTGGATCTTCTT CTGCTTCTCAGTCAGAAGGT ACAN ACTGCTGCAGACCAGGAGGT TCCTCGGGGGTGACGATGCT FABP4 5'-GGGTCACAGCACCCTCCTGA-3' 5'-TGGTGGCAAAGCCCACTCCTAC-3' [beta]-actin 5'-GACAGGATGCAGAAGGAGATTACT-3' 5'-TGATCCACATCTGCTGGAAGGT-3'
ekzonunda, daha once bildirilmis, cerceve kaymasina yol acan c.1147delC (p.H383Mfs*75) mutasyonu heterozigot tasidigi saptanmisti (13, 14).
Ozellikle organ nakli, malignite gibi immun yetmezlige yol acan durumlarda, menenjit, pnomoni, osteomyelit, kateterle iliskili infeksiyonlar ve sepsise neden olduklari bildirilmistir (31-34).
An upregulation of VCAN was also observed after 7, 14, 21, and 28 days of chondrogenic stimulation (Figure 3(a)), while no amplification was detected for mRNA corresponding to COL2A1 and ACAN (Figure 3(a)).
[1] Choi ve ark.lari [30] asker adaylari ile yaptiklari calismada cocukluk doneminde ihmal edilen ya da aile ici siddet gorenlerin psikolojik dayaniklilik duzeylerinin dusuk oldugunu belirlemisler ve zorlanmaya yol acan durumlara uyumda dayanikliligin onemli oldugunu vurgulamislardir.
Akut apandisite yol acan nedenler arasinda paraziter enfeksiyonlar ozellikle de Enterobius vermicularis akilda tutulmali, tani sirasinda anamnezde parazit oykusu ayrintili sorgulanmalidir.
Group I consisted four isolates with creamy white colony (AcPb, AcOs, AcSl and AcJg), group II contained of four isolates with creamy black colony (AcNd, AcAb, AcAn and AcDl), group III consisted two isolates with off white colony (AcHl and AcSt), group IV consisted two isolates with grayish black colony (AcBd and AcYt), group V consisted two isolates with light gray colony (AcJl and AcNs), group VI consisted three isolates with brown colony (AcWs, AcAk and AcBl), group VII consisted two isolates with olivaceous black colony (AcLt and AcNb) and group VIII consisted a single isolate with yellowish colony (AcAm).
Another shopkeeper, Hamdi Acan, stated that they are one the suffered part of the curfew and called for peace and brotherhood to end clashes.
#Silvan 'da halka ateE- acan keskin niE-ancynyn vurulma any ...
Ilk kez 1959 yilinda Hirayama ve arkadaslari tanimlamislar ve bu bulgularin, daha once bilinen dejeneratif ve progresif muskuler atrofiye yol acan hastaliklarin hic birine uymadigina dikkat cekmislerdir (2,3).