ATP4B

ATP4B

A gene on chromosome 13q34 that belongs to a family of P-type cation-transporting ATPases; it is composed of heterodimers consisting of a high molecular weight catalytic alpha subunit and a smaller, heavily glycosylated beta subunit, which catalyse the hydrolysis of ATP coupled with the exchange of H+ and K+ ions across the plasma membrane and are responsible for gastric acid secretion. Overactivity of H+, K+-ATPases causes gastric inflammation, and are the pharmacologic target for managing peptic ulcers, dyspepsia and gastro-oesophageal reflux disease (GERD/GORD).
References in periodicals archive ?
Housekeeping genes GAPDH (b), ACTB (c), G6PD (d), ALDOA (e), TAF (f), and GPI (g) and nonliver genes ATP4A (h), ATP4B (i), PGC (j), and MSN (k) exhibited similar expression among all study groups.
Gene Sequence 5'-3' Size Tm Reference or gene (bp) accession number G0S2 F: gtcgccttacgtttggacttgc 156 58 [19] R: caggtaactccgctcaggtgc ATP4B F: cccctgcaggtggaatactt 160 58 NM001001258.1 R: ggatcttgcacacgatgacc GSTO1 F: attacctcatctggccctgg 150 58 NM214050.1 R: ctcgaaggtctctcggttca CST3 F: cgagtacaacaaagcgagca 193 60 NM001044602.1 R: cagcgttttcttctgcaggt FECH F: gatcgcgtttaccagtgacc 180 60 NM001170523.1 R: cgctcattggactggatgtg MX2 F: aggcaaccaagagggaaatc 131 60 NM001097416.1 R: cacactgatatgcccgatga B2M F: ttcacaccgctccagtag 166 60 [20] R: ccagatacatagcagttcagg PPIA F: cacaaacggttcccagtttt 171 60 [21] R: tgtccacagtcagcaatggt TABLE 2: Summary of the RNA-sequencing and mapping.
[Source:RefSeq mRNA;Acc:NM_213801] ENSSSCG00000021818 ecto-NOX disulfide-thiol exchanger 1 [Source:HGNC Symbol;Acc:25474] ENSSSCG00000009544 collagen, type IV, alpha 1 [Source:HGNC Symbol;Acc:2202] ENSSSCG00000009561 Sus scrofa ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), mRNA.