A gene on chromosome 1p21 that encodes an alpha 1 (catalytic) subunit of the family of P-type cation transport ATPases and subfamily of Na+/K+ -ATPases. These Na+/K+ -ATPases are heterodimers composed of a large alpha subunit and a smaller beta subunit, and are responsible for establishing and maintaining the electrochemical gradients of Na and K ions across plasma membranes. These electrochemical gradients are required for osmoregulation, sodium-coupled transport of various organic and inorganic molecules and electrical excitability of nerve and muscle.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
In addition, treatment with propranolol in this individual resulted in differential expression of ITPR2, CALM3, KCNK1, and ATPase [Na.sup.+]/[K.sup.+] transporting subunit alpha 1 (ATP1A1).
ATP1A1, ATPase [Na.sup.+]/[K.sup.+] transporting subunit alpha 1; ATP1B1, ATPase [Na.sup.+]/[K.sup.+] transporting subunit beta 1; CALM3, calmodulin 3; CAMK2B, Calcium/calmodulin-dependent protein kinase type II beta chain; Cmax, maximum concentration in blood plasma; CV, coefficient of variation; DMSO, dimethyl sulfoxide; hERG, human ethera-go-go-related gene; ITPR2, inositol 1,4,5-trisphosphate receptor, type 2; iPSC, induced pluripotent stem cell; IVIVE, in vitro-to-in vivo extrapolation; PLN, phospholamban; KCNK1, potassium channel subfamily K member 1; PRKACA, catalytic subunit a of protein kinase A; RED, rapid equilibrium dialysis; RFU, relative fluorescence units
Bidirectional Sanger sequencing was performed for targeted mutation detection in the KCNJ5, ATP1A1, ATP2B3, CACNA1D, CACNA1H, and PRKACA genes using DNA extracted from the tumor tissues of the 22 A/CPA patients.
Further, no ATP1A1, ATP2B3, CACNA1D, or CACNA1H mutations were detected.
Gene GenBank Accession number NOS1 XM_017598257 sGC M57405 [Na.sup.+]/[K.sup.+]-ATPase (Atp1a1) NM_012504 [beta]-Actin (Actb) NM_031144 Gene Sequence(5-3) NOS1 F: GGCCCTTTTAATGAGGGTTGC R: TCTGTGCTAAGTAGCCGCTC sGC F: TCACCCCCATACCCTTCTGT R: GGTAGACTCTGTTGCGGCTT [Na.sup.+]/[K.sup.+]-ATPase (Atp1a1) F: TGGCATCCGAAGTGCTACAG R: CCAGATCACCAACGACGACA [beta]-Actin (Actb) F: CCGCGAGTACAACCTTCTTG R: CAGTTGGTGACAATGCCGTG Table 2: Effect of C.
Therefore, related target genes were also listed, such as ATP1A1, CYP27B1, DHCR7, EBP, GLB1, HSD11B2, HSD17B1, HSD17B3, SRD5A1, and SRD5A2.
This work then led to the discovery of various plasma membrane channel mutations [sodium/potassium-transporting ATPase subunit alpha-1 (ATP1A1), plasma membrane calcium-transporting ATPase 3 (ATP2B3), and voltage-dependent calcium channel type L alpha 1D subunit (CACNA1D)] in other APAs.
During the past 2 years, considerable interest has been generated by the discovery of sporadic mutations in potassium channels (KCNJ5), calcium channels (CACNA1D), and ATPases (ATP1A1 and ATP2B3; Figure 2, C).
Porcine chromosome SSC 4p13 contains a synteny group, with F13B, ATP1B1, GBA, ATP1A1, IVL, and two microsatellites S0001, S0067 (Andersson et al., 1994; Marklund et al., 1999).
(b) Gene symbol (c) Gene name (c) 2 PPM [O.sub.3] J02999 Rab2 ras-related protein RAB2 L19698 Rala GTP binding protein (Ral A) X07287 Pkrcg protein kinase C-[gamma] J03552 Mug1 plasma proteinase inhibitor D85760 Gna12 guanine nucleotide-binding protein a-12 M99567 PIcb3 phospholipase C [beta]-3 U00620 Cfs2 GM-CSF M59980 Kcnd2 voltage-gated K+ channel protein M83666 Hck Hck tyrosine protein kinase, p56 AF020777 Ptk2 focal adhesion kinase AF000300 Lyn lyn A tyrosine kinase 5 PPM [O.sub.3] U46034 Mmp11 matrix metal loproteinase 11 D55627 Rbl2 retinoblastoma-like 2 M95738 Slc6a11 Na+/K+ dependent GABA transporter M28647 Atp1a1 Na+/K+ATPaseed subunit U93306 Kdr VEGFR-2 M20637 Plcd1 phospholipase C delta 1 Accession no.
Cattle Multiple breeds Linear regression PLA2G5, ATP1A1, (1,500) DAG1 Belgian Blue (26) Case-control ATPA2A1 (ASSHOM/ASSIST) Belgian Blue (31) Case-control SLC6A5 (ASSHOM/ASSIST) Italian Chianina Case-control ABCA12 (12) (ASSHOM/ASSIST) Holstein cows Case-control (Plink) EDN2, SOD1, (245) PARP1 etc Black/Red Angus Case-control (Plink) MC1R (76) Holstein bulls Linear regression/ DGAT1, ABCG2, (5,360) Bayesian methods Integrin jj2 etc.