ANGPT1

ANGPT1

A gene on chromosome 8q23.1 that encodes angiopoietin 1, a secreted glycoprotein which, like other angiopoietins, binds to endothelial cell-specific tyrosine-protein kinase receptor. It plays a key role in mediating interactions between the endothelium and surrounding matrix and mesenchyme, andit  inhibits endothelial permeability. Angiopoietin 1 plays a role in regulating angiogenesis; endothelial cell survival, proliferation, migration, adhesion and spreading; reorganisation of the actin cytoskeleton; and maintains vascular quiescence. It contributes to blood vessel maturation and stability and may be involved in cardiac embryogenesis.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
Malachowski et al., "VEGF, ANGPT1, ANGPT2, and MMP-9 expression in the autologous hematopoietic stem cell transplantation and its impact on the time to engraftment," Annals of Hematology, vol.
The susceptibility loci juvenile idiopathic arthritis shares with other autoimmune diseases extend to PTPN2, COG6, and ANGPT1. Arthritis Rheum 2010;62:3265-76.
The current concept is that FNH develops as a vascular malformation as a result of dysregulation of angiopoietin genes (ANGPT1 and ANGPT2).
Three significant SNPs on GGA2 were found to associate with dry matter content in breast and were located in the vicinity of or within angiopoietin 1 (ANGPT1).
ANGPT1, TIE2, PDGFR-B, CDH5, S1PR1, FGF2, Shh, and TGFRB1), and blood vessel maturation/formation factor (e.g.
Among the angiopoietins (angiopoietin-1, angiopoietin-2, and angiopoietin-4 in humans), angiopoietin-1 (ANGPT1) is known as a constitutive agonist of TIE2.
In COT, hypoxia increased (P<0.03) overall mRNA expression of vascular endothelial growth factor (VEGF) by 177 [+ or -] 15%, placental growth factor (P1GF) by 195 [+ or -] 14%, angiopoietin-2 (ANGPT2) by 180 [+ or -] 11% and ANGPT receptor Tek by 130 [+ or -] 6%, and decreased (P<0.01) expression of ANGPT1 to 79 [+ or -] 5% compared with normal [O.sub.2].
One of the cells composing these HSPC niche is mesenchymal stem cells (MSCs) which control important functions of HSPCs through direct cell-to-cell contacts, the formation of an extracellular matrix network, and secretion or suppression of endogenous cytokines and factor such as C-X-C motif chemokine 12 (CXCL12, also known as stromal cell-derived factor 1, SDF1), SCF, angiopoietin 1 (ANGPT1), vascular cell adhesion molecule 1 (VCAM1), and TPO [8-10].
Although significant changes in angiopoietin-1 (ANGPT1) mRNA expression were not observed between each condition, mRNA expression tended to be elevated in Pre and Post in Hypo Tr.
The best-characterized ligands are ANGPT1 and ANGFT2 (Gale and Yancopoulos 1999; Thomas and Augustin 2009).
Table 1 Gene Forward primer Reverse primer [beta]-Actin TCCCTGGAGAAGAGCTACGA AGCACTGTGTTGGCGTACAG Shh GATGTCTGCTGCTAGTCCTCG CACCTCTGAGTCATCAGCCTG Slit3 TGATGGCAACGAGGAGAGTA ACGGCTGTTAGGTGGTTTCC HGF CTCACACCCGCTGGGAGTAC TCCTTGACCTTGGATGCATTC HIF-1[alpha] CAGCAACTTGAGGAAGTACC CAGGGTCAGCACTACTTCG VEGFA GCCTTGCTGCTCTACCTCCA ATGATTCTGCCCTCCTCCTTCT bFGF GCTGGTGATGGGAGTTGTATTT CTGCCGCCTAAAGCCATATT ANGPT1 GCTCACCATCATCTCCCTTATC CTCACAGACTCAATCACCTTCC