AKT2

AKT2

A gene on chromosome 19q13.1, which encodes a protein of the subfamily serine/threonine kinases containing SH2 (Src homology 2)-like domains, and phosphorylates several known proteins.

Molecular pathology
The gene is amplified and overexpressed in some primary ovarian tumours and pancreatic ductal carcinomas.
Mentioned in ?
References in periodicals archive ?
Within the AKT cascade, the response variable consisted of eight correlated gene expression values for each placenta--that is, two biopsies per placenta and four target genes (BDNF, AKT1, AKT2, and AKT3) measured in each biopsy.
MicroRNA-184 inhibits neuroblastoma cell survival through targeting the serine/threonine kinase AKT2.
38,39) Three AKT isoforms (AKT1, AKT2 and AKT3) can mediate downstream events through PI3K.
AKT2, a putative oncogene encoding a member of a subfamily of protein-serine/threonine kinases, is amplified in human ovarian carcinomas.
For this reason, in this study we sought to evaluate gene amplification of EGFR, C-MYC, MYCN, MYCL1, ERBB2, and AKT2 in both women with normal cytology and patients with preneoplastic and neoplastic lesions of cervical cancer.
Se detectaron frecuentes mutaciones no descritas en la via de PI3K o en otras vias de kinasas, por ejemplo, en los tres genes que codifican los componentes de la va PI3K/Akt (PDK1, AKT2 y kinasa activada por p21 (PAK4)) en cancer colorrectal.
Gene Forward primer Reverse primer sequence (5'-3') sequence (5'- 3') P53 CCCCAGCCAAAGAAGAAAC CTCACGCCCACGGATAAT P21 GCTGGTGGCTATTTGTCCT CATGCGTTCTGACGGACAT COX-2 CTTCACGCATCAGTTTTTCAAG TCACCGTAAATATGATTTAAGTCCAC NFkB CTGGCAGCTCTTCTCAAAGC TCCAGGTCATAGAGAGGCTCA BCL-2 AGTACCTGAACCGGCACCT GCCGTACAGTTCCACAAAGG BAX AGCAAACTGGTGCTCAAGG TCTTGGATCCAGCCCAAC CASPASE-9 AAGCCCAAGCTCTTTTTCATC AGCAAACTGGTGCTCAAGG AKT2 CTCACACAGTCACCGAGAGC TGGGTCTGGAAGGCATACTT PTEN GCACAAGAGGCCCTAGATTTC CGCCTCTGACTGGGAATAGT LC3 CATGAGCGAGTTGGTCAAGA CCATGCTGTGCTGGTTCA GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC Table 4 Treatment groups.
An interesting observation was noted for sample CTC003, in which CTC status was defined as negative by AdnaGen assay on the basis of the low expression of 7 selected genes [EPCAM (epithelial cell adhesion molecule), MUC1 (mucin 1, cell surface associated), ERBB2 (v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2, [HER2]), AKT2 (v-akt murine thymoma viral oncogene homolog 2), PIK3CA (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha), TWIST1 (twist family bHLH transcription factor 1), and ALDH1A1 (aldehyde dehydrogenase 1 family, member A1)], but still showed an expression for PAM50 panel genes not dissimilar from that of true CTC-positive samples.
And scientists at the University of Cambridge blame mutations in the AKT2 gene for the condition.
De los 17 genes restantes asociados al fenotipo HLFC contenidos en el modulo URFA, tres de ellos tienen funciones conocidas en el metabolismo lipidico (ABCC6, AKT2, HSD11B1) y uno mas que puede estar relacionado por su homologia con otra enzima (PNPLA4).
Alleles Tested3 Gene Alleles Tested AKT1 E17K (rs34409589), F35L AKT2 C574-1G>T, V90L AKT3 Q124L BRAF L597S/R/Q/V V600E/K/R/L G469V/R/S/E/A G466V JAK2 V617F KRAS Composite assays for codon 12 mutations G13V/D A59T Q61E/K/L/R/P/H MET T1010I MTOR A8S, K42M, L2201L, L888F, M1747L, S1821S PIK3CA E542K, E545K, Q546K, H1047R/L, M1043L, S541F PTEN G251C, R130G, R233 * STAT3 D661V STAT4 D661Y STAT5 G402C STAT6 N647I STAT7 Y640F (a) With Custom MassARRAY Chip on Sequenom Platform, Sequenom, San Diego, California.
Studies conducted in the past have shown that a chromosomal inversion - a genetic misalignment, where part of the chromosome containing the DLX5 gene gets flipped around during cell division cooperates with another known oncogene, AKT2, to drive cancer in mice.