ADIPOQ


Also found in: Dictionary, Acronyms.
Related to ADIPOQ: Adiponectin, Resistin

ADIPOQ

The gene on chromosome 3q27 which encodes adiponectin, a key adipokine involved in the control of fat metabolism and insulin sensitivity. ADIPOQ is only expressed only in adipose tissue.
Mentioned in ?
References in periodicals archive ?
The aims of this study were: i) to determine six common single nucleotide polymorphisms (SNPs) in the genes that encode ADIPOQ, LEP and its receptor (LEPR), and RETN, ii) to analyse adipokine plasma levels in subgroups of systemically healthy individuals with or without CP and individuals with both T2DM and CP to investigate the possible impacts of these adipokines on the etiopathogenesis of CP.
Product Gene name Primer size (bp) Leptin 5'GGT TGT CCA GGG TTG ATC TC 3' 110 bp 5'GTG GGA GAC AGG GTT CTA CT3' Ghrl 5'GCT GTC TTC AGG CAC CAT CT3' 113 bp 5'TTC TCT GCT GGG CTT TCT GG5' Igf1 5'CAA GTC CAG AGA GGA AGC TAT G3' 155 bp 5'CCG AGA GGT GGA GTG ATT TG3' AdipoQ 5'GCA CGA GGG ATG CTA CTG TT3' 127 bp 5'CAC AAG TTC CCT TGG GTG GA3' Gapdh 5'ACT CCA CTC ACG GCA AAT TC3' 150 bp 5'CAG TAG ACT CCA CGA CAT ACT C3' Table 2: The statistical results for the AL, CCR, and ICR diet groups' libraries.
Name Sequence 1 AdipoQ F 5' GCAGTCTGTGGTTCTGATTCCATAC R 5'GCCCTTGAGTCGTGGTTTCC 2 AP2 F 5' TGGTTGATTTTCCATCCCAT R 5' GCCAGGAATTTGACGAAGTC 3 CEBPA F 5' TATAGGCTGGGCTTCCCCTT R 5' AGCTTTCTGGTGTGACTCGG 4 PPAR[gamma]2 F 5' TTCTCCTATTGACCCAGAAAGC R 5'CTCCACTTTGATTGCACTTTGG 5 PCK1 F 5' TTACCAATGTGGCCGAGACC R 5' GCACAAGGTTCCCCATCCTC 6 CNTFR F 5' GCGACTCTAGCCTTGTCACC R 5' GACTGTGTCTCTGGGCGTAG 7 LPL F 5' CTTGGAGATGTGGACCAGC R 5'GTGCCATACAGAGAAATCTC 8 LIPE F 5'AGCCACGATGGGTGGAATG R 5'ACCAGCGACTGTGTCATTGT 9 ACACB F 5' ACAGTCCTGAGATCCCCCTC R 5' GTTCAGCCGGGTGGACTTTA 10 [beta]-actin F 5' AGCCATGTACGTTGCTA
Methods: Most deleterious nonsynonymous single nucleotide polymorphisms in the coding region of the ADIPOQ gene were investigated using SNP databases, and detected nonsynonymous variants were analyzed in silico from the standpoint of relevant protein function and stability by using SIFT, PolyPhen-2, PROVEAN and MUpro, I-Mutant2.0 tools, respectively.
Hendriks, "Moderate alcohol consumption increases insulin sensitivity and ADIPOQ expression in postmenopausal women: a randomised, crossover trial," Diabetologia, vol.
The top down-regulated genes were Major urinary protein 4 (Mup4), Major urinary protein 2 (Mup2), Carbonic anhydrase III (Ca3), Adiponectin (Adipoq), TATA box binding protein (Tbp), Stearoyl-CoA desaturase 1 (Scd1), ELOVL family member 5, elongation of long chain fatty acids (ElvolS), and tubulin (Tubg2) (Table 4).
To provide molecular evidence for the differentiation of preadipocytes into lipid-filling adipocytes, quantitative real-time PCR was used to evaluate the relative expression levels of genes coding for adipocyte-specific cytokines, adiponectin (ADIPOQ), leptin (LEP), and leptin receptor (LEPR) (Table 1).
Adiponectin: Most of the studies investigating the association of genetic variations in the adiponectin gene (ADIPOQ, T45G in exon 2 and G276T in intron 2) with pathogenesis of PCOS have provided negative results (52,98,116), but some of them showed relation with serum adiponectin levels (116,117).
The genes are thought to include ADIPOQ, which is found in about 10 percent of young people but in nearly 30 percent of people living past 100.
Pasche from the University of Alabama, Birmingham, and associates examined the interaction between 10 variants in the genes for adiponectin (ADIPOQ) and adiponectin receptor 1 (ADIPOR1) and colorectal cancer risk.
The control vector (pcDNA3.1) and the adiponectin (ADIPOQ)-overexpressing vector (pcDNA3.1-ADIPOQ) were obtained from GenePharma (China).