ADHFE1

(redirected from ADH8)

ADHFE1

A gene on chromosome 8q13.1, that encodes a hydroxyacid-oxoacid transhydrogenase (EC 1.1.99.24), which is responsible for the oxidation of 4-hydroxybutyrate.
References in periodicals archive ?
Eight primers (Table-1) of yeast were successful in amplifying DNA in the sample viz., ADH1, ADH2, ADH3, ADH4, ADH6, ADH5, ADH7 and ADH8 primers, Saccharomyces sppstrains used on wine production identifying variations at DNA level among the yeasts (Raton, 2004).
No Locus Primer Sequences (5CE'-3CE') 1 ARS304 (ADH1) F:GCAAAGTTATTATGTTAAAGAAAAAG R:ATATTCGTTGTAAACTCATATACTTA 2 ARS310 (ADH2) F:ACGTCTCCTCCAAGCCC R:CATATTCCCTAGAAAAA 3 ARS313(ADH3) F:GAAAAGATTTGATGAAGACCAA R:AAGCTACTTTTAAATAAGTTTT 4 ARS923(ADH4) F:CTAGTGCTTAAGTTCT R:GAGTTTAATTTGTTGT 6 ARS 207(ADH6) F:GTGTTAGTACGTTAAATGCTACGACT R:TTGAGTTTGTACAAAGGAAAGCTGTA 7 ARS111(ADH7) F:CGGCTATACAACCATATTTAAGTAAA R:GCAAAAACTCCTCTTTGTCTT 8 ARS1218 (ADH8) F:TTTTTTTAAGGGAAAATGCAAGCGTTTT R:CACCGATTTTTTGGATAAAATGTATTC Specific primers were designed using the Saccharomyces cerevisiae genome database (SGD; www.yeastgenome.org).
Phylogenetic analysis and computer modeling of the deduced amino acid sequence data identified one of them as an orthologue of mammalian Adh5 and the other as an orthologue of zebrafish Adh8. To study the effect of ethanol on regulation of ADH5 and ADH8 protein and mRNA expression during embryonic development of medaka, fertilized eggs were exposed to waterborne ethanol concentrations of 100 and 400 mM during the first two days of development and sacrificed in ovo at 2, 4, and 6 days post fertilization (dpf).