ADH6

ADH6

A gene on chromosome 4q23 that encodes class-V alcohol dehydrogenase, which like other alcohol dehydrogenases metabolises various substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids and lipid peroxidation products. It is expressed in the stomach and liver, and has a glucocorticoid response element upstream of its 5' UTR.
References in periodicals archive ?
To date, seven different ADH genes--ADH1A, ADH IB, ADH 1C, ADH4, ADH5, ADH6, and ADH7--have been identified clustered together on the long arm of chromosome 4 (Edenberg 2007).
Eight primers (Table-1) of yeast were successful in amplifying DNA in the sample viz., ADH1, ADH2, ADH3, ADH4, ADH6, ADH5, ADH7 and ADH8 primers, Saccharomyces sppstrains used on wine production identifying variations at DNA level among the yeasts (Raton, 2004).
No Locus Primer Sequences (5CE'-3CE') 1 ARS304 (ADH1) F:GCAAAGTTATTATGTTAAAGAAAAAG R:ATATTCGTTGTAAACTCATATACTTA 2 ARS310 (ADH2) F:ACGTCTCCTCCAAGCCC R:CATATTCCCTAGAAAAA 3 ARS313(ADH3) F:GAAAAGATTTGATGAAGACCAA R:AAGCTACTTTTAAATAAGTTTT 4 ARS923(ADH4) F:CTAGTGCTTAAGTTCT R:GAGTTTAATTTGTTGT 6 ARS 207(ADH6) F:GTGTTAGTACGTTAAATGCTACGACT R:TTGAGTTTGTACAAAGGAAAGCTGTA 7 ARS111(ADH7) F:CGGCTATACAACCATATTTAAGTAAA R:GCAAAAACTCCTCTTTGTCTT 8 ARS1218 (ADH8) F:TTTTTTTAAGGGAAAATGCAAGCGTTTT R:CACCGATTTTTTGGATAAAATGTATTC Specific primers were designed using the Saccharomyces cerevisiae genome database (SGD; www.yeastgenome.org).
This cluster contains, in addition to the genes encoding ADH class I isozymes, the genes ADH4, ADHS, ADH6, and ADHI, which encode other ADH enzymes.
More recent evidence suggests that genetic variants in the ADHIA, ADHIB, ADHI C ADHS, ADH6, and ADH7 genes are associated with illicit drug dependence and that this association is not purely attributable to co-morbid alcohol dependence (Luo et al.
For example, several studies found other variations in and near the ADH1B gene, as well as in or near the ADH4, ADH1C, ADH5, ADH6, and ADH7 genes that affect risk for alcoholism or the level of alcohol consumption (see the article by Hurley and Edenberg, pp.
Humans have seven different genes, called ADH1A, ADH1B, ADH1C, ADH4, ADH5, ADH6, and ADH7, that encode medium-chain ADHs (see Table 1).
* Although the ADH6 gene has been identified, there are as yet no physiological data on the functions of the ADH6 enzyme.
Table 1 Human Alcohol Dehydrogenase (ADH) Isozymes Gene Nomenclature [K.sub.m] [V.sub.max] Class New Former Protein mM [min.sup.-1] I ADH1A ADH1 [alpha] 4.0 30 ADH1B*1 ADH2*1 [[beta].sub.1] 0.05 4 ADH1B*2 ADH2*2 [[beta].sub.2] 0.9 350 ADH1B*3 ADH2*3 [[beta].sub.3] 40.0 300 ADH1C*1 ADH3*1 [[gamma].sub.1] 1.0 90 ADH1C*2 ADH3*2 [[gamma].sub.2] 0.6 40 II ADH4 ADH4 [pi] 30.0 20 III ADH5 ADH5 [chi] >1,000 100 IV ADH7 ADH7 [sigma]([mu]) 30.0 1,800 V ADH6 ADH6 ?