ADH1B

(redirected from ADH2)
Also found in: Acronyms.

ADH1B

A gene on chromosome 4q21-23 that encodes a member of the alcohol dehydrogenase family, which metabolise various substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids and lipid peroxidation products. The encoded protein plays a major role in ethanol catabolism.
References in periodicals archive ?
In fact, the profile of recombinant CBHII production was similar to that previously reported for the ADH2 promoter, with a complete induction in the late stationary phase (>36 h culture) [22].
The allelic and genotypic frequencies of genes encoding ADH2, ADH3, ALDH2 and CYP2E1 in subjects with alcoholism, consumption problematic of alcohol (PAC) and control subjects are shown in Tables 2, 3, 4 and 5.
Each reaction contained 3 ml of DNA extract, 10 pmoles of each Adh2 primer (Table 2), 2.5 mM of each dNTP, 2 mM Mg[Cl.sub.2], 1X PCR buffer ([(N[H.sub.4]).sub.2]S[O.sub.4]), 5 units of Taq DNA polymerase (Fermentas) and sterile double distilled water.
Duplex polymerase chain reaction with confronting twopair primers (PCR-CTPP) for genotyping alcohol dehydrogenase beta subunit (ADH2) and aldehyde dehydrogenase 2 (ALDH2).
In the lot and ADH2 except Gta dur and Vitron in which there has been an increase in their diameter compared to that recorded in optimal conditions, the remaining genotypes showed regression in their diameter.
Genotyping of alcohol dehydrogenase at the ADH2 and ADH3 loci by using a polymerase chain reaction and restriction-fragment-length polymorphism in Chinese alcoholic cirrhotics and nonalcoholics.
Isoform Restriction (primer ID) Primer sequence enzyme ALDH2 (YC3) 5'-TTG GTG GCT AGA AGA TGT C-3' MboII ALDH2 (YC4) 5'-CCA CAC TCA CAG TTT TCT CTT-3' MboII ADH2 (A2F) 5'-ATT CTA AAT TGT TTA ATT CAA GAA G-3' MsII ADH2 (A2R) 5'-ACT AAC ACA GAA TTA CTG GAC-3' MsII ADH2 (424) 5'-TGG ACT CTC ACA ACA AGC ATG GT-3' AluI ADH2 (290) 5'-TTT CTT TGG AAA GCC CCC AT-3' AluI ADH2 (352) 5'-TCT TTC CTA TTG CAG TAG C-3' AluI ADH3 (321) 5'-GCT TTA AGA GTA AAT ATT CTG TCC CC-3' SspI ADH3 (351) 5'-AAT CTA CCT CTT TCC GAA GC-3' SspI Table 2.
Association of the ADH2 genotypes with skin responses after ethanol exposure in Japanese male university students.
No Locus Primer Sequences (5CE'-3CE') 1 ARS304 (ADH1) F:GCAAAGTTATTATGTTAAAGAAAAAG R:ATATTCGTTGTAAACTCATATACTTA 2 ARS310 (ADH2) F:ACGTCTCCTCCAAGCCC R:CATATTCCCTAGAAAAA 3 ARS313(ADH3) F:GAAAAGATTTGATGAAGACCAA R:AAGCTACTTTTAAATAAGTTTT 4 ARS923(ADH4) F:CTAGTGCTTAAGTTCT R:GAGTTTAATTTGTTGT 6 ARS 207(ADH6) F:GTGTTAGTACGTTAAATGCTACGACT R:TTGAGTTTGTACAAAGGAAAGCTGTA 7 ARS111(ADH7) F:CGGCTATACAACCATATTTAAGTAAA R:GCAAAAACTCCTCTTTGTCTT 8 ARS1218 (ADH8) F:TTTTTTTAAGGGAAAATGCAAGCGTTTT R:CACCGATTTTTTGGATAAAATGTATTC Specific primers were designed using the Saccharomyces cerevisiae genome database (SGD; www.yeastgenome.org).
These environmental factors can interact with an individual's genetic background, making the individual more or less susceptible to genetic risk factors, such as the presence of certain variants of the enzymes monoamine oxidase A (MAOA) or ADH2. Investigating such bridges between gene variants, environment, and endophenotype or phenotype is at the heart of systems genetics and is likely to yield the greatest insight into disease etiology.
In addition, functional polymorphisms of alcohol dehydrogenase (ADH2) and aldehyde dehydrogenase (ALDH2) genes have been shown to have a significant impact on alcohol metabolism in the liver, and thus, may contribute to vulnerability to alcohol abuse and dependence, alcohol-related liver diseases and cancers.