ACTB


Also found in: Acronyms.

ACTB

A gene on chromosome 7p22 that encodes beta actin, which coexists with gamma actins as a major cytoskeletal component and mediator of internal cell motility. ACTB is also an older gene name for what is formally (per HUGO) known as ACTG1, see there.
References in periodicals archive ?
Table 1 Primer sequences for perivitellins and reference genes of Pomacea canaliculata Gene Forward Reverse primer primer PcOvo (a) GTGGCTACATCCCTGTTGCT CCCTGAACGAGTGCTTGACT PcPV2 (b) GGTGTTGGGCAAGTTGATGT ACGAGAAGAGAAACGGGTGT ACTB (c) TCACCATTGGCAACGAGCGAT TCTCGTGAATACCAGCCGACT GAPDH (c) CAACCTCAAAACCGATGCCA GACAAAGCGA[GAMMA]TAGTCAGTGGA Gene Amplicon Annealing Amplification length temperature efficiency (bp) ([degrees]C) (%) PcOvo (a) 154 55 96.7 PcPV2 (b) 183 53 96.6 ACTB (c) 87 56 93.7 GAPDH (c) 184 55 96.3 (a) Primer design based on PcOvo subunit 1 (accession no.
Visualized transcripts are marked according to color, yellow signals = KRAS wt, red signals = KRAS mutant (mt), and pink signals = ACTB control.
On the y- axis the 2[conjunction][DELTA]Ct values for the relative mRNA expression of the investigated target genes is shown after normalization against the reference gene ACTB (actin, beta).
On the other hand, we included in the analysis a soluble nuclear-enriched mRNA, beta-actin (ACTB), and miR-21, which has been previously detected not only in the cytosol but also in the nucleus of human cells [37] (Figure 1(e)).
While other proteins (GSK3B, POU5F1, MAPK14, CREB1, SOX2, KLF4, PRKACA, MAPK10, STAT1, ACTB, TUBB3, MYC, GAPDH, AKT1, and CTNNB1) are related with process of aging, neuronal diseases, cardiovascular diseases, abnormal brain development, mental retardation, schizophrenia, and mycobacterial and viral infections [60-62].
ACTB was used as internal control, and the primer sequences are as follows: WT-1 F: 5'-CCCTACAGCAGTGACAAT-3', R: 5'-CTCTGCCCTTCTGTCCAT-3'; Pax2 F: 5'-GGTCTGGACTTTAAGAGATGT-3', R: 5'-TGCTGCTGGGTGAAGGTGT-3'; Pax8 F: 5'-AGCAAGATCCTTGGCAGGT-3', R: 5'-GCAAACATGGTAGGGTTCTG-3'; Lim-1 F: 5'-GACTTCTTCCGATGTTTCGGT-3', R: 5'-GAGAGCTGCTTGTTACACAT-3'; ACTB F: 5'-GAAGATCAAGATCATTGCTCCT-3', R: 5'-TACTCCTGCTTGCTGATCCACA-3'.
The cut-off value for the ACTB PCR-ELISA was calculated as the mean of the absorbance readings of the negative controls plus three standard deviations and was determined in the development phase of the assay.
NURR1 Forward primer 5' CGGGTCGGTTTACTACAAG 3' 111 AB017586.1 Reverse primer 5' TGGTGGAAGTTGTGGAGAG 3' FOXA1 Forward primer 5' GTTACAGGGAGGACTACCA 3' 111 NM004496.3 Reverse primer 5' TCCAAGGCAGTTCCAATAC 3' ACTB Forward primer 5' TCGTGCGTACATTAAGG 3' 175 X00351.1 Reverse primer 5' AAGGAAGGCTGGAAGAGT 3' TABLE 2: Genes with corresponding primers which are used for SSCP analysis.
PARP1 levels were normalized to the average of ACTB and GAPDH, and miR103a-2-5p and miR-585-5p were normalized to U6.
Antibodies specific for AQP4 and [beta]-actin (ACTB) were from Santa Cruz Biotechnology, Inc.
[beta]-actin is encoded by ACTB, and pathogenic variations in this gene have typically been associated with Baraitser-Winter cerebrofrontofacial syndrome (BRWS; OMIM 243310), a congenital malformation syndrome typified by short stature, craniofacial anomalies, and cerebral anomalies [4, 5].