ABCC3

ABCC3

A gene on chromosome 17q22 that encodes a protein of the MRP subfamily of the superfamily of ATP-binding cassette (ABC) transporters, which transport various molecules across extra- and intracellular membranes, many of which are involved in multidrug resistance. ABCC3 is thought to play a role in the transport of biliary and intestinal excretion of organic anions.
References in periodicals archive ?
El proceso de absorcion se realiza por transporte activo usando transportador PepTl [23], mientras que los transportadores ABCC3 y ABCC4 son los responsables de la excrecion [24],
Experimentalmente esta demostrado que cefadroxilo es sustrato del transportador de absorcion PepTl y de los transportadores de excrecion ABCC3 y ABCC4 y algunos entes regulatorios limitan las bioexenciones a aquellos farmacos que atraviesan la barrera intestinal solo por difusion pasiva, por lo que cefadroxilo no podria ser candidato a bioexencion.
Oral availability of Cefadroxil depends on ABCC3 and ABCC4.
Genotyping analyses of ABCB1 C3435T ABCG2 C421A and ABCC3 C-211T were conducted using the TaqMan methodology.
In this study we planned to investigate the role of three genetic polymorphisms (ABCB1 C3435T ABCG2 c421A and ABCC3 C-211T) in response to chemotherapy and overall survival of osteosarcoma patients.
Genotyping analyses of ABCB1 C3435T ABCG2 C421A and ABCC3 C-211T were conducted using the TaqMan methodology in a 384-well plate format on the Sequenom MassARRAY platform and read by Sequence Detection software on the ABI prism 7900 instrument (Sequenom San Diego USA) which described in previous study.
Table-I: Primers used for ABCB1 C3435T ABCG2 c421A and ABCC3 C-211T polymorphisms.
ABCC3 C-211T###GACTCGACTCCTGGACTGTTAGC###CCCTACCCCAGTGCCTCT
However individuals with ABCG2 C421A and ABCC3 C-211T polymorphisms had no association with response to chemotherapy in patients with osteosarcoma.
One of the downstream targets for AhR is BCRP encoded by ABCC3 gene [159-161].
Isola, "Amplification and overexpression of the ABCC3 (MRP3) gene in primary breast cancer," Genes Chromosomes and Cancer, vol.
Functional genomics identifies ABCC3 as a mediator of taxane resistance in HER2-amplified breast cancer," Cancer Research, vol.