AACT


Also found in: Acronyms.

SERPINA3

A gene on chromosome 14q32.1 that encodes a member of the serine protease inhibitor (serpin) family, which is a plasma protease inhibitor.

Molecular pathology
Variations in SERPINA3’s sequence have been implicated in Alzheimer's disease; SERPINA3 deficiency has been linked to liver disease. SERPINA3 mutations have been found in patients with Parkinson disease and COPD.

AACT

American Academy of Clinical Toxicology.
Mentioned in ?
References in periodicals archive ?
Al Anwar Ceramic Tiles Company (AACT) enjoys the rare distinction of being the first manufacturer of ceramic tiles in Oman.
The Alliance for the Advancement of Cellular Therapies (AACT) 2015 Conference, awarded the Jordanian researchers for their novel work on treatment of Type 1 Diabetes.
The normalized fold changes of the target gene mRNA expression were expressed as [2.sup.-[DELTA][DELTA]CT], where AACT is equal to [[DELTA]CT.sub.treated sample] - [[DELTA]CT.sub.contror]
The American Association of Chemistry Teachers (AACT) is tremendous and I applaud ACS for taking this on and providing resources to that front line.
The Dow Chemical Company and the American Association of Chemistry Teachers (AACT) are partnering to invigorate chemistry education and support STEM (science, technology, engineering and math) education in the nation's schools.
Each sample (2 [micro]L cDNA) was tested with real-time SYBR Green PCR reagent (Life Technologies) with specific primers: 18S (forward: AGTCCCTG CCCTTTGTACACA; reverse: CGAT CCGAGGGCCTCACTA), GAPDH (forward: TGGCACAGTCAAGGCTGAGA; reverse: CTTCTGAGTGGCAGTGATGG), bone morphogenetic protein 2 (Bmp2) (forward: AAGC CAT C G AG G AACT TT CA GA; reverse: TCAC AGGA AATTTTGA GCTGGC), and osteocalcin (OCN): (forward: TCTGACAAAGCCTTCATGTCCA; reverse: AACGGTGGTGCCATAGAT).
The threshold cycle (CT) value was determined and the relative mRNA expression of eNOS, TGF[beta]1, bFGF, and VEGF was calculated as follows: 2aacT with AACT = CT GAPDH - CT gene of interest.
Incheon International Airport Corporation in Seoul has underwritten 50 percent of the purchase price of more than 7,000 biodegradable vinyl pallet covers used by handling companies Korea Airport Service, Swissport and AACT.
Fold change was determined via the standard AACt method [21, 22]and statistical significance assessed by a conventional t-test with unequal variances [23].