AACT


Also found in: Acronyms.

SERPINA3

A gene on chromosome 14q32.1 that encodes a member of the serine protease inhibitor (serpin) family, which is a plasma protease inhibitor.

Molecular pathology
Variations in SERPINA3’s sequence have been implicated in Alzheimer's disease; SERPINA3 deficiency has been linked to liver disease. SERPINA3 mutations have been found in patients with Parkinson disease and COPD.

AACT

American Academy of Clinical Toxicology.
Mentioned in ?
References in periodicals archive ?
Through its STEMtheGAP[TM] initiatives, including the AACT partnership, Dow strives to provide more resources to teachers, drive excitement in young people around STEM topics and increase the number of students who choose STEM majors, ultimately preparing these students to be successful in STEM careers.
Whereas F&A assume that the normative and attitudinal components are fully independent,(3) AACT is posited in this model to be affected by the normative beliefs and their associated motivations to comply, in addition to the outcome beliefs and evaluations.
The AACT has a rigorous screening process for educational schools and colleges that want to offer degrees and diplomas to students above and beyond the certification and certificate program level.
Al Jazeera Services (AJSS) which holds a 37 per cent stake in AACT has been the best performing stock in the market year-to-date.
The company has also finalised its plans for placing orders for equipment," said A Suresh, Financial Controller of AACT, which has a dominant position in the domestic ceramic tiles market with its popular Al Shams brand.
Her showstopping performance of the famous song about "dreams that you dare to dream" garnered an award for Best Performance in a Cameo Role from the AACT International 2010 Community Theater Festival.
Each sample (2 [micro]L cDNA) was tested with real-time SYBR Green PCR reagent (Life Technologies) with specific primers: 18S (forward: AGTCCCTG CCCTTTGTACACA; reverse: CGAT CCGAGGGCCTCACTA), GAPDH (forward: TGGCACAGTCAAGGCTGAGA; reverse: CTTCTGAGTGGCAGTGATGG), bone morphogenetic protein 2 (Bmp2) (forward: AAGC CAT C G AG G AACT TT CA GA; reverse: TCAC AGGA AATTTTGA GCTGGC), and osteocalcin (OCN): (forward: TCTGACAAAGCCTTCATGTCCA; reverse: AACGGTGGTGCCATAGAT).
This will be in two phases of three million each a€"enabling a total investment of about RO12 million,a€Y said AACT Managing Director A.
With a MainStage, a Stage II, and 1,500 volunteers producing at least 25 shows this year, the year-long celebration includes hosting the AACT International 2010 in late June with shows from 14 theater troupes representing five continents.
The 129,000-square-foot (12,000-square-meter) Atlas Air Cargo Terminal will be operated by AACT Company Limited, a joint venture that includes Atlas Air and Sharp, Inc.
To determine the effect the inhibitors had upon influenza RNA levels, the ACT values of the inhibitor-treated samples were subtracted from the ACT values in the presence of solvent alone to yield a AACT value.