telomeres


Also found in: Dictionary, Thesaurus, Encyclopedia.

telomeres

The sections of DNA that forms the natural end of a CHROMOSOME. The points that resist union with fragments of other chromosomes. Telomeres consist of repeated groups of the base sequence TTAGGG, where T, A and G represent the bases thymine, adenine and guanine, respectively. Formation of telomeres involves the shaving-off of some junk DNA at the chromosome end. There is a limit to the number of times that this can occur because of the deficiency of telomerase reverse transcriptase, and this is believed to be the reason for the upper limit in the number of times cells can reproduce. Overexpression of this enzyme allows otherwise normal cells to proliferate indefinitely. Telomere length is a function of age but there is evidence that it may also be an X-linked familial trait. Telomeres and telomerase are fundamental in the biology of ageing, cancer, stem cells and the disease dyskeratosis congenita.
References in periodicals archive ?
Led by Deliang Tang and Frederica Perera at Columbia University's Mailman School of Public Health, the research team analyzed telomere length in the umbilical cord blood of 255 newborns, about half of whom were born before the plant closure and half conceived and born after.
In many cell types, telomeres also serve as biological countdown clocks, being shortened with every cell division until their reduced length triggers the death of the cell or an inactive, non-dividing state called senescence.
In contrast, in most cancer cells, levels of the enzyme telomerase, which lengthens telomeres, are elevated, allowing them to divide indefinitely.
Results revealed that the telomeres of those who struggled with alcohol abuse were shorter than the controls, something that the researchers believe is a hallmark sign of how alcohol abuse speeds up aging on a cellular level.
ZBTB48 has recently been found to directly bind to telomeres that are abnormally long, and to limit them from growing further.
The researchers found that while patients with AML had significantly shorter telomeres than patients with MDS, whether telomeres were shorter or longer than the functioning threshold did not appear to lead to any significant differences in survival times.
TEHRAN (FNA)- Children and teens exposed to high levels of traffic-related air pollution have evidence of a specific type of DNA damage called telomere shortening, reports a new study.
Telomeres are the caps that protect the ends of our 23 pairs of chromosomes--the twisted strands of DNA in the nucleus of each of our cells.
In comparison with subjects who reported no coffee intake, women who consumed two cups of coffee per day had a 29% higher chance of having average telomere length that was above the median of the group.
Telomeres are bits of DNA that protect the ends of chromosomes from unraveling or degrading.
The forward and reverse primer for the telomeres were 5-ACACT AAGGTTTGGGTTTGGGTTTGGGTT TGGGTTAGTGT-3' and 5'-TGTTA GGTATCCCTATCCCTATCCCTATCC CTATCCCTAACA-3'.
In a study using zebrafish, which have human-like telomeres, a team of Portuguese scientists led by Miguel Godinho Ferreira, PhD, of the Instituto Gulbenkian de Ciencia, Portugal, found that over time telomeres shorten to critical lengths only in specific tissues, and independent of their proliferation (growth) rate.

Full browser ?