polymorphism


Also found in: Dictionary, Thesaurus, Legal, Encyclopedia, Wikipedia.
Related to polymorphism: encapsulation

polymorphism

 [pol″e-mor´fizm]
the ability to exist in several different forms.
balanced polymorphism an equilibrium mixture of homozygotes and heterozygotes maintained by natural selection against both homozygotes.
genetic polymorphism the occurrence together in the same population of two or more genetically determined phenotypes in such proportions that the rarest of them cannot be maintained merely by recurrent mutation.
single nucleotide polymorphism (SNP) a genetic polymorphism between two genomes that is based on deletion, insertion, or exchange of a single nucleotide.

pol·y·mor·phism

(pol'ē-mōr'fizm),
Occurrence in more than one form; existence in the same species or other natural group of more than one morphologic type.
Synonym(s): pleomorphism

polymorphism

/poly·mor·phism/ (-mor´fizm) the quality of existing in several different forms.
balanced polymorphism  an equilibrium mixture of homozygotes and heterozygotes maintained by natural selection against both homozygotes.

polymorphism

(pŏl′ē-môr′fĭz′əm)
n.
1. Biology The occurrence of more than one form, as several alleles of a particular gene or winged and wingless forms of the same species.
2. Chemistry Crystallization of a compound in at least two distinct forms. Also called pleomorphism.

pol′y·mor′phic, pol′y·mor′phous adj.
pol′y·mor′phous·ly adv.

polymorphism

[pol′ēmôr′fizəm]
Etymology: Gk, polys + morphe, form
1 the state or quality of existing or occurring in several different forms.
2 the state or quality of appearing in different forms at different stages of development. Kinds of polymorphism are balanced polymorphism and genetic polymorphism. polymorphic, adj.

pol·y·mor·phism

(pol'ē-mōr'fizm)
Occurrence in more than one form; existence in the same species or other natural group of more than one morphologic type.
Synonym(s): pleomorphism.

polymorphism

1. Occurring in many different shapes.
2. In genetics, the existence of different ALLELES of the same gene in different genomes. See also RESTRICTION FRAGMENT LENGTH POLYMORPHISM.

polymorphism

see a GENETIC POLYMORPHISM.

pol·y·mor·phism

(pol'ē-mōr'fizm)
Occurrence in more than one form; existence in same species or other natural group of more than one morphologic type.
Synonym(s): pleomorphism.

polymorphism

the quality of existing in several different forms.

balanced polymorphism
an equilibrium mixture of homozygotes and heterozygotes maintained by natural selection against both homozygotes.
References in periodicals archive ?
The selected primary sequences for Gly389Arg polymorphism in the ADRBI gene were as follows: Forward Primer: 5' CGCTCTGCTGGCTGCCCTTCTTCC 3'and Reverse Primer: 5' TGGGCTTCGAGTTCACCTGCTATC 3'.
IL-10 -1082G/A and -592C/A polymorphisms were analyzed using restriction fragment length polymorphism (RFLP) and agarose gel electrophoresis methods in both patient and control groups.
Association of polymorphisms in the cytochrome P450 CYP2C9 with warfarin dose requirement is well documented across a variety of ethnic populations.
The present investigation was undertaken on 300 patients of CAD and 300 healthy controls matched for age and sex to elucidate the role of different candidate risk factors(increased oxidant stress, higher than normal levels of cell adhesion molecules, low levels of bioavailable nitric oxide, low levels of HDL) and related gene polymorphisms (nitric oxide synthase-NOS and paraoxonase-PON 1, promoter and coding region polymorphisms; apo A1, A IV, gene cluster promoter region polymorphisms) in the molecular pathogenesis of CAD and evaluating their relative significance in the assessment of the risk and severity of CAD.
Reaction mixture for the detection of each polymorphism was made with 10 [micro]l of PCR product, 20 U of the respective enzymes and 10X buffer in different cocktails.
Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis.
A genotype (SIP/RFP) harboring three amino acid polymorphisms 39 (S/R), 185 (I/F) and 240 (S/P) was found in few goats.
Potentially, by combining screening for some of these polymorphisms in the pathway we may get a sort of pharmacogenetic index--a simple number that conveys the likelihood of efficacy or toxicity," Dr.
Another variant is a mononucleotide repeat (A)n polymorphism that varies in length from 13 to 24 adenosines (12 alleles); poly (A) occurs in the 3' untranslated region of the VDR gene [13].
Association of the ER22/23EK polymorphism in the glucocorticoid receptor gene with survival and C-reactive protein levels in elderly men.

Full browser ?