

The pigment in bacterial chromatophores bleached by light of wavelengths about 870 nm.
References in periodicals archive ?
The building, which cost the province P870 thousand, is located just a few steps from the provincial directors office.
Meanwhile, the weighted average rent in BGC of P870 per sqm per month is comparable to slightly higher when compared to Makati Grade A buildings.
Primers Sequence (5'-3') P231 acgcagaaggcaatgtcatacc P637 aatccacatcggccagatcg P869 aaggacatgatgctatggctgg P870 ggaagaacagtatgtcgagc P1217 ccggatcaagagctaccaac P1238 gagttggtagctcttgatcc P1668 gccacctctgacttgagcgt P2100 ccgctcacaattccacacaa P2510 gaagtccagctgccagaaac P2958 ggtctgcaccatcgtcaacc P3478 cggcgagttctgttaggtcc P3937 ggagctgcatgtgtcagagg P3956 cctctgacacatgcagctcc Table 2.
1 million); and the 1,400 hectare Lancaster New City in the boundaries of Imus, Kawit, and Gen Trias in Cavite (prices start at P870,000).
Meanwhile, the upgrading of the MRT 3's ancillary systems to integrate the 48 brand new LRVs into the existing system will cost P870 million.
47 billion, less P870 million from the original P23.
All winners received cash prizes totaling P870,000 and a scholarship to a four-week entrepreneurship training at the Citi Microenterprise Development Center.
Catalina said the shipment worth P870 thousand and composed of ten tons of mina-angan variety from Banaue and hungduan from Ifugao, and five tons are ulikan from Pasil and Lubuagan in Kalinga were consolidated by Rice Terraces Farmers Cooperative (RTFC), in cooperation with a non-government organization Rice Inc.
The nickel segment posted an P850 million increase, to P870 million from only P20 million in 2013.
Iloilo City, Iloilo - The provincial government of Iloilo turned over P870,000 in financial aid to families of those who died from super-typhoon "Yolanda" last year.
said 175 plastic bags containing 174 kilos of shabu worth P870 million were found in a Mitsubishi Montero at a rented warehouse in Greenville Subdivision.