MYOD1

(redirected from myogenic differentiation 1)

MYOD1

A gene on chromosome 11p15.4 that regulates myogenesis by encoding MyoD1, a nuclear phosphoprotein with partial homology to the myc family of oncoproteins, which binds to the enhancer sequences of the muscle-specific creatine phosphokinase gene, inhibiting DNA synthesis and cell proliferation. MyoD1 belongs to the basic helix-loop-helix (bHLH) transcription factor family and the myogenic factors subfamily. It regulates muscle cell differentiation by inducing cell cycle arrest, a prerequisite for myogenesis, and is involved in muscle regeneration.
Mentioned in ?
References in periodicals archive ?
Previous studies reported that porcine myogenic differentiation 1 (MyoD1) gene has been mapped to swine chromosome 2p14-p17 which is involved in the regulation of the proliferation and differentiation of skeletal muscle cells.
The cells were negative for myogenic differentiation 1, myogenin, desmin, HMB-45, S-100 protein, and prolactin.
Sequence (5'-3') (bp) [beta]-actin NM_205518 F: GAGAAATTGTGCGTGACATCA 152 R: CCTGAACCTCTCATTGCCA HDAC2 NM_204831 F: GGGACCTTAGGGACATTGGT 139 R: CTGGGCTGGTACATCTCCA PAX7 NM_205065 F: CATCCTGGGCGACAAAG 114 R: TGCTCGGCAGTGAAAGTG MYOD1 NM_204214 F: TCAACGAGGCCTTTGAGACC 111 R: CCTGCAGGCTCTCGATGTAG HDAC2, histone deacetylase 2; PAX7, paired box 7; MYOD1, myogenic differentiation 1.