myelocytomatosis

my·e·lo·cy·to·ma·to·sis

(mī'ĕ-lō-sī'tō-mă-tō'sis),
A form of tumor involving chiefly the myelocytes.

leukochloroma

An obsolete term for a mass of aggregated myelocytes.

my·e·lo·cy·to·ma·to·sis

(mī'ĕ-lō-sī-tō'ă-tō'sis)
A form of tumor involving chiefly the myelocytes.

myelocytomatosis

one of the virus-induced diseases in the leukosis-sarcoma group of diseases of fowl. It is characterized by tumors of the skull, ribs and limb bones. There is emaciation, weakness, pallor of the comb and a course of several months. There are often bony protuberances at the head and on the thorax and shanks.
References in periodicals archive ?
Genes that show amplification include erb-b2 receptor tyrosine kinase 2 (ERBB2),which can be treated with anti-human epidermal growth factor receptor 2 (HER2) agents such as trastuzumab, cyclin D1 (CCND1), fibroblast growth factor receptor 1 (FGFR1) and v-myc avian myelocytomatosis viral oncogene homolog (MYC) (6).
4) as a myc-related gene, which was eventually called MYCN (v-myc avian myelocytomatosis viral oncogene neuroblastomaderived homolog).
In a recent study, the treatment with bortezomib, which is a selective proteasome inhibitor, induced Myelocytomatosis Viral Oncogene Neuroblastoma (MYCN) downregulated p53 expression, leading to cell survival in neuroblastoma [148].
Indeed, several MYB targets, including B-cell CLL/lymphoma 2 (BCL2), v-Kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (Kit), CD34, baculoviral IAP repeat-containing 3, v-Myc avian myelocytomatosis viral oncogene homolog, and mitotic arrest deficient-like 1, were shown to be upregulated in ACC.
Human Myc proto-oncogene protein is a basic dimerization motif helix-loop-helix leucine zipper (HLH-LZ) containing transcription factor that was initially discovered to be the cellular homologue of v-myc myelocytomatosis viral oncogene (Vennstrom et al.
This study provided cytogenetic findings in a CLL/SLL patient with v-myc avian myelocytomatosis viral oncogene homolog ( C-MYC )-amplification by FISH, in which SNP arrays detected profound genomic upheaval due to chromothripsis that may lead to malignant transformation.
3 26 SYBR_CAPDH_rev TTGATTTTGGAGGGATCTCG 20 CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and S-phase expressed 1; HIST, histone cluster; ITPR1, inositol 1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis viral oncogene homolog; RHOJ, ras homolog gene family, member J; SRGAP3, SLIT-ROBO Rho GIPase activating protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.
Although most patients have a good prognosis, some infants with MYCN-amplified (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) or MYCN) neuroblastoma show poor survival rates.
Transcription factors such as p53, v-myc avian myelocytomatosis viral oncogene homolog (MYC), myoblast determination protein 1 (MYOD1), zinc finger E-box binding homeobox (ZEB) 1 and 2, and p27Kip1 (cyclin-dependent kinase inhibitor 1B) regulate the transcription of miR-34, miR-17, miR-1, miR-15a, miR-200, and miR-221 which play an important role in prostate cancer as either tumor promoters or tumor suppressors (7-11) (Fig.
Differentiated cells are acquired by biopsies from human tissues and in vitro cultured under stem cell transcription factors, such as SOX2 (SRY-box containing gene 2), c-Myc (v-myc avian myelocytomatosis viral oncogene homolog), OCT4 (octamer-binding transcription factor 3), and KlF4 (Kruppel-like factor 4).
In rats THC mediates its physiological effects via cannabinoid receptor type 1 (CB1) and type 2 (CB2) binding, activating intracellular G-proteins which provide signals to a variety of effectors such as ion channels, the mitogen-activated protein kinase (MAPK) cascade and induce myelocytomatosis oncogene (c-MYC) expression (Howlett et al.
01 process v-myc myelocytomatosis viral oncogene homolog (avian) (MYC) AJ719659 Gallus gallus 4.