molecular beacon


Also found in: Wikipedia.

molecular beacon

a dual labelled OLIGONUCLEOTIDE PROBE, with a fluorescent reporter group at one end and a fluorescence quencher group at the other, that reports the presence of target nucleic acid molecules in solution by fluorescing. In the absence of a HYBRIDIZATION target, the probe forms an internal HAIRPIN structure that brings the reporter and quencher groups into close proximity, resulting in the quenching of fluorescence. In the presence of a hybridization target, the probe molecule unfolds and hybridizes to the target. Reporter and quencher are now physically separated and the reporter dye can fluoresce on stimulation, indicative of hybrid formation. Such a probe is useful in situations where it is not possible or desirable to isolate probe-target hybrids from an excess of the probe.
References in periodicals archive ?
Currently, the World Health Organisation (WHO) has endorsed molecular beacon technology for the direct detection of MTB by using ultra-sensitive polymerase chain reaction (PCR) technology.
This decision is a major independent validation of Miacom's proprietary molecular beacon technology being successfully applied in the hemoFISH assays.
Detection is by a fluorescently-labeled molecular beacon.
The ANSR system uses an innovative isothermal DNA amplification process and fluorescent molecular beacon technology for detection of the pathogen target.
A real-time PCR assay with 6 molecular beacon probes was performed by using an iQ5 iCycler instrument (Bio-Rad, Hercules, CA, USA) to screen for mutations associated with isoniazid and rifampin resistance (19).
Next, 15 nanograms of the DNA was amplified using Brilliant QPCR Master Mix (Stratagene, La Jolla, CA) with gene-specific primers and each molecular beacon on a Mx3000P Real-time PCR System (Stratagene) The oligonucleotides were as follows (shown in 5'-3' orientation): forward primer AAGAGTGGTTCTCGTTCTTACG, reverse primer GTGAGGGTGGGCGCAGAG, Allele C Beacon FAM-CCGGATCAGTTGTGTCTTCG CATCGTAAAGGACGATCCGG-BHQ1 and Allele G Beacon HEX-CCGGATCAGTTGTGTCTTC GGATCGTAAAGGACGATCCGG-BHQ1.
The sensitivity and accuracy of molecular beacon and TaqMan[R] probe PCR assays were compared with the conventional USDA microbiological procedure using artificially contaminated RTE meats.
Molecular beacon hybridization probes specific to mRNA targets will be conjugated to SERS NP-labels to allow optical detection utilising Raman microscopy in human cancer tissue sections.
Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA.
Scorpion probes build further on this idea by, in effect, using a molecular beacon which also has one of the target PCR primers added to one end of the beacon region.
A novel ultrasensitive, molecular beacon (MB) based sensing system for the mercury ion ([Hg.
The molecular beacon fluorescence in situ hybridization (FISH) assay performed during the fourth infection trial used modified reverse PCR primer sequences for genogroup I and II viruses (28).
Full browser ?