haemolysin


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.

haemolysin

See hemolysin.

he·mol·y·sin

(hē-mol'i-sin)
1. Any substance elaborated by a living agent and capable of lysing red blood cells and liberating their hemoglobin.
Synonym(s): erythrocytolysin, erythrolysin, haemolysin.
2. A sensitizing (complement-fixing) antibody that combines with red blood cells of the antigenic type that stimulated formation of the hemolysin, so that complement fixes with the antibody-cell union and causes dissolution of the cells.

haemolysin

a property of blood serum which can destroy red blood cells.

he·mol·y·sin

(hē-mol'i-sin)
1. Any substance elaborated by a living agent and capable of lysing red blood cells and liberating their hemoglobin.
Synonym(s): erythrocytolysin, erythrolysin, haemolysin.
2. A sensitizing (complement-fixing) antibody that combines with red blood cells of the antigenic type that stimulated formation of the hemolysin.
Synonym(s): haemolysin.
References in periodicals archive ?
Our study aims to evaluate the prevalence of virulence determinants like biofilm formation, haemolysin production and gelatinase production in Enterococcus species isolated from clinical specimens.
faecium Total Factors n= 31 n=45 (n=76) Haemolysin 17 9 26 (34%) Gelatinase 14 0 14 (18%) Biofilm 5 23 28 (39%)
21] In Candida secretion of haemolysin followed by iron acquisition helps in penetration into deep tissues.
1) Species Coagulase Haemolysin Production (%) Production (%) C.
Haemolysin assay--Culture supernatant of individual isolates of B.
cereus Gene Primer (5' [right arrow] 3') Amplicon (bp) hblA B component of haemolysin BL 320 HBLA1:GTGCAGATGTTGATGCCGAT HBLA2:ATGCCACTGCGTGGACATAT hblD L1 component of haemolysin BL 430 LIA:AATCAAGAGCTGTCACGAAT L1B:CACCAATTGACCATGCTAAT hblC L2 component of haemolysin BL 750 L2A:AATGGTCATCGGAACTCTAT L2B:CTCGCTGTTCTGCTGTTAAT nheA A component of non-haemolytic ET 500 nheA 344S: TACGCTAAGGAGGGGCA nheA 843A: GTTTTTATTGCTTCATCGGCT nheB B component of non-haemolytic ET 770 nheB 1500S:CTATCAGCACTTATGGCAG nheB 2269A:ACTCCTAGCGGTGTTCC nheC C component of non-haemolytic ET 582 nheC 2820S:CGGTAGTGATTTGCTGGG nheC 3401A:CAGCATTCGTACTTGCCAA Table II.
HAEMOLYSIN: UPEC produces two types of haemolysin--Beta haemolysin (cell bound) and Alpha haemolysin (cell free factor).
MARKERS N=200 N=50 1 Haemolysin production 50 (25%) 8 (16%) Haemagglutination activity a.
Enteroaggregative Escherichia coli strains secrete a heat-labile toxin antigenically related to Escherichia coli haemolysin.
hydrophila produces several extracellular products such as proteases, haemolysins, aerolysin, cytolytic enterotoxins that are related with its pathogenicity (virulence) (Kingombe et al.