glyceraldehyde 3-phosphate


Also found in: Acronyms, Wikipedia.

glyc·er·al·de·hyde 3-phos·phate

(glis'ĕr-al'dĕ-hīd fos'fāt),
An intermediate in the glycolytic breakdown of d-glucose; one of the products of the splitting of fructose 1,6-bisphosphate under the catalytic influence of fructose-bisphosphate aldolase.

glyceraldehyde 3-phosphate (GALP)

see PGAL.
References in periodicals archive ?
1 Reverse qRT-PCR, quantitative real time polymerase chain reaction; TNFSF15, tumor necrosis factor superfamily 15; IL-8, interleukin-8; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
DAPI, 4,'6-diamidino-2- phenylindole; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; FITC, fluorescein isothiocyanate; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.
deg- rees]C) GAPDH TGTCAAGGCTGAGAACGGGA AGGCCAGGGAGCATTCTTCT 60 MyoD ATTGGCAATGAGAGGTTCAGG TAGAGCCTCCAATCCAGACAGA 60 Myogenin AGCCTCAACCAGCAGGAGC TGCGCCAGCTCAGTTTTGGA 60 Desmin CTGAAGGATGAGATGGCC GGTCGCCTCGCTCACCAC 60 GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Abbreviations AKI: Acute kidney injury RTEC: Renal tubular epithelial cell CLP: Cecal ligation and puncture RSV: Resveratrol ac-SOD2: Acetylated superoxide dismutase 2 SOD: Superoxide dismutase SIRT: Sirtuin MD: Mitochondrial dysfunction GSH: Reduced form of glutathione GSSG: Oxidized form of glutathione CAT: Catalase TUNEL: Terminal deoxynucleotidyl transferase dUTP nick-end labeling PVDF: Polyvinylidene fluoride WST: Water-soluble tetrazolium salt GAPDH: Glyceraldehyde 3-phosphate dehydrogenase [DELTA][PSI]m: Mitochondrial membrane potential ATP: Adenosine triphosphate mPTP: Mitochondrial permeability transition pore HPF: High-power field.
MAC-T, mammary alveolar; DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a ubiquitously expressed control gene, was also analyzed to confirm the success of RNA extraction and the reverse transcription and PCR reactions (4).
The mRNA levels of target genes were normalised to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (ACT).
They found that glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA concentrations were significantly higher in patients with hepatocellular carcinoma than in healthy controls.
PCR products were normalized against the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene.
A realtime quantitative RT-PCR method was used for transcript quantification of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene.
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH): 30 cycles of 1 min at 94 [degrees]C, 1 min at 62 [degrees]C, and 1 min at 72 [degrees]C, followed by 5 min at 72 [degrees]C.
For a control gene, we used a TaqMan glyceraldehyde 3-phosphate dehydrogenase (GAPDH) Control Reagent (PE Applied Biosystems).