glyceraldehyde


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to glyceraldehyde: acetone

glyceraldehyde

 [glis″er-al´dĕ-hīd]
a compound, glyceric aldehyde, formed by the oxidation of glycerol.

glyc·er·al·de·hyde

(glis'ĕr-al'dĕ-hīd),
A triose and the simplest optically active aldose; the dextrorotatory isomer is taken as the structural reference point for all d compounds, the levorotatory isomer for all l compounds.
Synonym(s): 2, 3-dihydroxypropranal, glyceric aldehyde

glyceraldehyde

/glyc·er·al·de·hyde/ (glis″er-al´dĕ-hīd) an aldose, the aldehyde form of the three-carbon sugar derived from the oxidation of glycerol; isomeric with dihydroxyacetone. The 3-phosphate derivative is an intermediate in the metabolism of glucose, in both the Embden-Meyerhof and pentose phosphate pathways.

glyceraldehyde

(glĭs′ə-răl′də-hīd′)
n.
A sweet colorless crystalline solid, C3H6O3, that is an intermediate compound in carbohydrate metabolism.

glyc·er·al·de·hyde

(glis'ĕr-al'dĕ-hīd)
A triose and the simplest optically active aldose; the dextrorotatory isomer is taken as the structural reference point for all d compounds, the levorotatory isomer for all l compounds.

glyceraldehyde

a compound, glyceric aldehyde, formed by the oxidation of glycerol.

glyceraldehyde phosphate dehydrogenase
an enzyme of the glycolytic pathway.
References in periodicals archive ?
DAPI, 4,'6-diamidino-2- phenylindole; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; FITC, fluorescein isothiocyanate; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling.
5] Human genes: FUS, fused in sarcoma; GAPDH, glyceraldehyde 3 phosphate dehydrogenase; CCND1, cyclin D1; MIR31, microRNA 31; SNORD48, small nucleolar RNA, C/D box 48.
IL-8, interleukin-8; TNFSF15, tumor necrosis factor superfamily 15; IELs, intraepithelial lymphocytes; qRT-PCR, quantitative real time polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
1 Reverse qRT-PCR, quantitative real time polymerase chain reaction; TNFSF15, tumor necrosis factor superfamily 15; IL-8, interleukin-8; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
deg- rees]C) GAPDH TGTCAAGGCTGAGAACGGGA AGGCCAGGGAGCATTCTTCT 60 MyoD ATTGGCAATGAGAGGTTCAGG TAGAGCCTCCAATCCAGACAGA 60 Myogenin AGCCTCAACCAGCAGGAGC TGCGCCAGCTCAGTTTTGGA 60 Desmin CTGAAGGATGAGATGGCC GGTCGCCTCGCTCACCAC 60 GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Abbreviations AKI: Acute kidney injury RTEC: Renal tubular epithelial cell CLP: Cecal ligation and puncture RSV: Resveratrol ac-SOD2: Acetylated superoxide dismutase 2 SOD: Superoxide dismutase SIRT: Sirtuin MD: Mitochondrial dysfunction GSH: Reduced form of glutathione GSSG: Oxidized form of glutathione CAT: Catalase TUNEL: Terminal deoxynucleotidyl transferase dUTP nick-end labeling PVDF: Polyvinylidene fluoride WST: Water-soluble tetrazolium salt GAPDH: Glyceraldehyde 3-phosphate dehydrogenase [DELTA][PSI]m: Mitochondrial membrane potential ATP: Adenosine triphosphate mPTP: Mitochondrial permeability transition pore HPF: High-power field.
A baseline rate was recorded, and the assay was initiated by the addition of 300 [[micro]liter] of 100 mM glyceraldehyde (45 mM).
The primers used for PCR were as follows: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (NM001034034), GGGTCATCATCTCTGCA CCT (forward), GGTCATAAGTCCCTCCACGA (reverse); Bcl-xL (NM001077486), CTCAGAGTAACCGGGAGCTG (forward), CCATTCACAGCAGGGCTATC (reverse); Bax (NM 173894), TCTGACGGCAATTTCAACTG (forward), TGGGT GTCCCAAAGTAGGAG (reverse); Caspase 8 (NM001045970.
The mRNA levels of target genes were normalised to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (ACT).
PCR products were normalized against the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene.
3] Nonstandard abbreviations: IVT, in vitro transcription; aRNA, antisense RNA; SMART, switching mechanism at the 5' end of the RNA transcript; dsDNA, double-stranded DNA; Ct, threshold cycle; Gapd, Mus musculus glyceraldehyde dehydrogenase gene; UTR, untranslated region; and Pbgd, Mus musculus porphobllinogen deaminase gene.