fluorescein isothiocyanate


Also found in: Dictionary, Thesaurus, Acronyms, Wikipedia.
Related to fluorescein isothiocyanate: FITC

fluor·es·ce·in i·so·thi·o·cy·a·nate (FITC),

(ī'sō-thī-ō-sī'ă-nāt),
a fluorochrome dye frequently coupled to antibodies that are used to locate and identify specific antigens.

fluor·es·ce·in i·so·thi·o·cy·a·nate

(FITC) (flōr-es'sē-in ī'sō-thī-ō-sī'ă-nāt)
A fluorochrome dye frequently coupled to antibodies that are used to locate and identify specific antigens.

fluorescein isothiocyanate (FITC)

A fluorescing dye used to label antibodies in immunofluorescence tests and research techniques.
References in periodicals archive ?
A method was described for comparing the fluorescence yields of a solution of fluorescein and a suspension of microspheres with immobilized fluorescein isothiocyanate (FITC).
After repeated rinsing, the sections were incubated for 2 hours at room temperature with fluorescein isothiocyanate or Texas red-labeled secondary antibodies.
Primer sequences, Probe sequences, Gene target 5' [right arrow] 3' 5' [right arrow] 3' Hcg[beta] GCTACTGCCCCACCATGACC 3'FITC (a)-TGCCTCAGGTGGTGTGC- AACTACCGC subunit GGACTCGAAGCGCACATCG TGGACTCGAAGCGCACAxTCG (b) Human actin CGGGACCTGACTGACTACCTCA CGGGACCTGACTGACTACCxTCA TGGCCATCTCTTGCTCGAAGT 3'FITC-CGCGCTCGGTGAGGATCTTCAT (a) FITC, fluorescein isothiocyanate.
After rinsing with PBS, we incubated the cells with fluorescein isothiocyanate (FITC)-conjugated goat anti-human antibodies (Sigma, Heidelberg, Germany) before applying bisbenzimide 33258 (Hoechst).
We monitored embryos for expression of GFP using a Zeiss microscope equipped with a fluorescein isothiocyanate (FITC) filter ([lambda] ex = 470 nm, [lambda] em = 515 nm).
We purchased William's medium E, insulin, collagenase, Hepes, L-glutamine, penicillin, and streptomycin, NAC, BSO, GSH, o-phthalaldehyde (OPT), and mouse fluorescein isothiocyanate (FITC) conjugate monoclonal anti-[Beta]-tubulin from Sigma (St.