cytochrome


Also found in: Dictionary, Thesaurus, Financial, Encyclopedia, Wikipedia.

cytochrome

 [si´to-krōm]
any of a class of hemoproteins, widely distributed in animal and plant tissue, whose main function is electron transport; distinguished according to their non–amino acid components as a, b, c, d, etc.

cy·to·chrome

(sī'tō-krōm),
A class of hemoprotein the principal biologic function of which is electron and/or hydrogen transport by virtue of a reversible valency change of the heme iron. Cytochromes are classified in four groups (a, b, c, and d) according to spectrochemical characteristics; many variants exist, particularly among bacteria and in green plants and algae, one being a variant of the c type cytochrome called cytochrome f. The mitochondrial system of cytochromes provides electron transport through cytochrome c oxidase to molecular oxygen as the terminal electron acceptor (respiration).
[cyto- + G. chrōma, color]

cytochrome

/cy·to·chrome/ (si´to-krōm) any of a class of hemoproteins, widely distributed in animal and plant tissues, whose main function is electron transport using the heme prosthetic group; distinguished according to their prosthetic groups, e.g., a, b, c, d, and P-450.

cytochrome

(sī′tə-krōm′)
n.
Any of a class of usually colored proteins that contain a heme group, are electron carriers, and catalyze oxidation-reduction reactions during cellular respiration.

cytochrome

[si′tōkrōm]
Etymology: Gk, kytos, cell, chroma, color
1 a class of hemoproteins whose function is electron transport. These proteins have the ability to change the valence of the heme iron, alternating between ferrous and ferric states.
2 proteins involved in mitochondrial electron transport systems associated with adenosine triphosphate (ATP) production.

cy·to·chrome

(sī'tō-krōm)
A class of hemoprotein the principal biologic function of which is electron or hydrogen transport by virtue of a reversible valency change of the heme iron. Many variants exist, particularly among bacteria and in green plants and algae, one being a variant of the c type cytochrome called cytochrome f. The mitochondrial system of cytochromes provides electron transport through cytochrome c oxidase to molecular oxygen as the terminal electron acceptor (respiration).
[cyto- + G. chrōma, color]

cytochrome

a protein pigment containing iron that is capable of being alternately oxidized and reduced, acting as an electron carrier in, for example, the ELECTRON TRANSPORT SYSTEM of a MITOCHONDRION.

Cytochrome

A substance that contains iron and acts as a hydrogen carrier for the eventual release of energy in aerobic respiration.
Mentioned in: Smoking

cy·to·chrome

(sī'tō-krōm)
A class of hemoprotein the principal biologic function of which is electron or hydrogen transport.
[cyto- + G. chrōma, color]

cytochrome (sī´təkrōm´),

n one of a class of hemoproteins that act as electron transport. Cytochromes are classified as
a, b, c, and
d.

cytochrome

any of a class of hemoproteins, widely distributed in animal and plant tissue, whose main function is electron transport; distinguished according to their prosthetic group as a, b, c and d.

cytochrome b5 reductase
a flavoprotein involved in the desaturation of fatty acids in the liver.
cytochrome oxidase
an a type cytochrome which contains copper and receives electrons from another cytochrome, of the c type, and transfers them to oxygen atoms allowing the oxygen to combine with hydrogen atoms to form water. A nutritional deficiency of copper leads to a general reduction in metabolic rate because of the absence of cytochrome oxidase a.
cytochrome system
the sum of cytochromes which play a part in the body's metabolic processes. Includes the cytochrome oxidases and cytochrome reductases.
References in periodicals archive ?
Polymorphisms were identified in cytochrome b, cytochrome c gene and d-loopregion (Table IV).
It has been reported earlier that the activity of AHH is mainly dependent on cytochrome P450 1A1/2 content [23, 30].
Detection for the translocation of cytochrome c, AIF, Bax, Bcl-xl and RAPR cleavage
Helicoverpa armigera cytochrome P450 (CYP6B7) was amplified from cDNA by polymerase chain reaction (PCR) by upstream primer (5' GCAGGATCCATGTGGGTCTTATATCTAC3') and downstream primer (5' GACGTCGACTTAAGATACAATCTTCCTAGG3'), respectively.
To test the capability of monitoring protein unfolding by ALMS, samples of cytochrome C (equine), at various degrees of denaturation, were reacted with acetic anhydride for 10 minutes.
In fact, [PGPs] can 'set up' or act as 'gatekeepers' for later P450 cytochrome actions," according to Jessica R.
based scientists collaborated in the cytochrome P450 work with medical researchers in Poland.
This agreement is another example of Astex's commitment to making its human cytochrome P450 technology available to other companies who could benefit or are already benefiting from its application in the discovery and development of novel drugs with reduced metabolic liabilities.
This article examines alcohol metabolism in the liver by the enzyme cytochrome P450 2E1 (CYP2E1) and the role of this enzyme in creating a harmful condition known as oxidative stress.
Doxorubicin treatment in vivo causes cytochrome c releae and cardiomyocyte apoptosis, as well as increased mitochondrial efficiency superoxide dismutase activity and Bcl-2: Bax Ratio 1.