corticotrophin


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.

corticotropin

 [kor″tĭ-ko-tro´pin]
1. a hormone secreted by the anterior lobe of the pituitary gland that stimulates the cortex of the adrenal gland to secrete its hormones, including corticosterone. If production of corticotropin falls below normal, the adrenal cortex decreases in size, and production of the cortical hormones declines.
2. a pharmaceutical preparation of animal-derived corticotropin, administered intravenously for diagnostic testing of adrenocortical function and subcutaneously or intramuscularly, in a slowly absorbed gel form (repository corticotropin), as an anticonvulsant for treating infantile spasms. Called also adrenocorticotropic hormone (ACTH), adrenocorticotropin, and corticotrophin.

corticotrophin

/cor·ti·co·tro·phin/ (kor´tĭ-ko-tro″fin) corticotropin.

corticotrophin

Corticotropin, adrenocorticotrophic hormone (ACTH), a hormone produced by the PITUITARY GLAND which stimulates the adrenal cortex to secrete steroids in response to stress.

corticotrophin

See ADRENOCORTICOTROPIC HORMONE.

Adrenocorticotropin (corticotrophin)

A hormone that acts on cells of the adrenal cortex, causing them to produce male sex hormones and hormones that control water and mineral balance in the body.
Mentioned in: Pituitary Dwarfism

corticotrophin

References in periodicals archive ?
President and Chief Executive Officer of Neurogen, said, "The combination of Neurogen's novel corticotrophin releasing factor chemotype, the substantial quantity of promising chemical leads from our Accelerated Intelligent Drug Discovery system, and Aventis' impressive development and commercial expertise comprise all the right elements for a successful effort.
Forward primer; CCTGACTATAATGTACAGATCCCTC Reverse primer; GCAGAATGACTAGGAAGGATGGCA Corticotrophin releasing factor (CRFA, Moore et al.
Complications of corticotrophin therapy in multiple sclerosis.
It was demonstrated by the authors that, once again, the group of patients who had haemorrhagic shock on admission, or the need for vasopressors beyond 24 hours, or who had exposure to etomidate more than 24 hours prior to the diagnosis of AI, were all associated with a statistically higher chance of being a 'non-responder' to a corticotrophin stimulation test.
The key classes of mechanism of action include guanylate cyclase type C receptor agonists, serotonin receptors targets, corticotrophin releasing factor 1 receptor antagonists, NK receptor targets and 5-aminosalicylate targets.
Bilateral inferior petrosal sinus sampling seems to be the most accurate method for distinguishing pituitary from ectopic production of corticotrophin (1).
Other changes, however, such as those involving the GABA system or a molecule called corticotrophin releasing factor (CRF) (which is involved in the brain's stress response system), appear to be associated more specifically with acute alcohol withdrawal.
The presence of neurokinin (NK) receptor antagonists and corticotrophin releasing factor (CRF) antagonists in the anxiety disorders pipeline have generated much interest among interviewed key opinion leaders.
Xerecept is a synthetic version of the natural peptide hormone Corticotrophin Releasing Factor.
The concentration of circulating corticotrophin releasing hormone mRNA in maternal plasma is elevated in preeclampsia.
Acthar[R] Gel (repository corticotrophin injection) for the treatment of infantile spasms.