antibiotic sensitivity


Also found in: Wikipedia.

an·ti·bi·ot·ic sen·si·tiv·i·ty

microbial susceptibility to antibiotics.
See also: antibiotic sensitivity test, minimal inhibitory concentration.

an·ti·bi·ot·ic sen·si·tiv·i·ty

(antē-bī-otik sensi-tivtē)
Microbial susceptibility to antibiotics.
References in periodicals archive ?
The authors investigated the BC contamination rate and changes in the antibiotic sensitivity profiles of selected organisms, and estimated the proportion of infections that were hospital acquired.
W2] Environmental wastes 2 Table 2: Primers used and their Sequences PRIMER SEQUENCE (5'-3') Reference SHV B1 ATGCGTTATATTCGCCTGTG (2) SHV B2 GTTAGCGTTGCCAGTGCTCG Bla TEM A2 TTACCAATGCTTAATCA Bla TEM A1 TAAAATTCTTGAAGACG CXT-M (forward) ACCGCGATATCGTTGGT (15) CXT-M (reverse) CGCTTTGCGATGTGCAG Table 3: Antibiotic sensitivity testing.
Antibiotic sensitivity test by disc diffusion technique: Growth from rapidly growing M.
Antibiotic sensitivity testing was carried out on at least 54 colonies grown over three age groups (18-39, 40-59, and 60+) to test the hypothesis that antibiotic resistance increases with human age.
Microbiologists base their antibiotic sensitivity studies on laboratory analyses of naked mutants (i.
Contract award: supply of reagents for the clinical pathology laboratory - microbiology (blood cultures and mycobacteria, identification and antibiotic sensitivity of bacteria - automated technique and molecular biology).
4) However, the prevalence of multidrug-resistant strains, especially in developing countries, (7) makes it obligatory to perform culture and antibiotic sensitivity for patients with persistent infection after failure of initial or repeated treatment.
The product is suited for subbing, which entails picking and transferring isolates from the primary plate to a secondary plate to confirm that its an anaerobe and to purify it for further identification and for determining antibiotic sensitivity.
Antibiotic sensitivity test was carried out for 15 selected Vibrio cholerae isolates after being confirmed through biochemical and serological tests.
The routine antibiotic sensitivity tests were put up for aminoglycosides [amikacin (30 [micro]g), gentamicin (10 [micro]g), netilmicin (30 [micro]g), tobramicin (10 [micro]g)], cephalosporin's [cefoperazone (75 [micro]g), cefepime (30 [micro]g), ceftazidime (30 [micro]g), ceftriaxone (30 [micro]g), ceftizoxime (30 [micro]g)], floroquinolones [ciprofloxacin (5 [micro]g), gatifloxacin (5 [micro]g), lomefloxacin (10 [micro]g)], carbapenems [imipenem (10 [micro]g), meropenem (10 [micro]g)], chloramphenicol (30 [micro]g) and piperacillin/tazobactum (100/10 [micro]g).
The organism was sensitive to imipenem and ciprofloxacin and resistant to cefotaxime and ceftriaxone, by the Stokes comparative disk-diffusion antibiotic sensitivity testing method (3).

Full browser ?