adipsin

Adipsin

A serine protease secreted by adipocytes into the circulation which is deficient in some animal models of obesity. It is identical to complement factor D.

adipsin

An enzyme secreted by fat cells, and also present in the Schwann cells of nerve fibres, that is thought to regulate fat metabolism. It acts on free lipoproteins and is concerned with fat oxidation. Its levels are markedly reduced in genetically obese mice. The full function of adipsin remains unclear.
References in periodicals archive ?
1993a) and; pioglitazone on cellular differentiation and expression of adipose-specific genes namely, adipsin and aP2, in 3T3-F44ZA cells have been reported.
adipsin, cathepsin S, leptin, adiponectin, chemerin, plasminogen activator inhibitor 1 (PAI-1), RBP-4, serum amyloid A1 (SAA-1), tissue inhibitor of metalloproteinase 1 (TIMP-1), and thrombopoietin.
adiponectin, adipsin, granulocyte-macrophage colony-stimulating factor (GM-CSF), hepatocyte growth factor (HGF), leptin, PAI-1, resistin, TIMP-1, and thrombopoietin (all R & D Systems), were performed according to the manufacturer's protocols.
For adiponectin, adipsin, HGF, leptin, PAI-1, resistin, TIMP-1, and thrombopoietin, the antibody pairs used for ELISA and MIA maybe identical, but the antibody clones were not disclosed by the ELISA manufacturer.
Markers specific for adipocytes such as aP-2, adipsin, lipoprotein lipase and phosphoenolpyruvate carboxykinase appeared in G8 myoblasts co-expressing both C/EBP[alpha] and PPAR[gamma].
Genetic variation at the adipsin locus and response to long-term over-feeding.
This experimental study of over-feeding of monozygotic twins provides new insights into the role of adipsin on individual differences in weight gain following over-feeding.
But Spiegelman's team now reports finding that a much smaller excess of TNF-alpha depresses the expression of the genes responsible for producing the proteins adipsin and glut4.
Gene Forward Primer Reverse Primer Adipsin (cfd) CGGATGACGACTCTGTGCAG CATCGCTTGTAGGGTTCAGGG Alkaline phosphatase TCCTGACCAAAAACCTCAAAGG TCGTTCATGCAGAGCCTGC aP2 TGGGGACCTGGAAACTCGT TCTCTGACCGGATGACGAC P-actin TGTTACCAACTGGGACGACA CTGGGTCATCTTTTCCAGGT P-catenin (mouse) ATGGAGCCGGACAGAAAAGC GAATCCAAGTAAGACTGCTGCT P-catenin (rat) GCTGACCTGATGGAGTTGGA TCTTCTTCCTCAGGATTGCC C/EBP a ATAAGAACAGCAACGAGTACC GCGGTCATTGTCACTGGTC C/EBP 5 CCACGACCCCTGCCATGTAT TGTGATTGCTGTTGAAGAGGTC Osteocalcin AGGGAGGATCAAGTCCCG GAACAGACTCCGGCGCTA Osterix ACTGGCTAGGTGGTGGTCAG GGTAGGGAGCTGGGTTAAGG PPAR-y TATGGGTGAAACTCTGGGA TGGCATCTCTGTGTCACCAT Runx-2 GCCGGGAATGATGAGAACTA GGACCGTCCACTGTCACTTT Type 1 collagen GCATGGCCAAGAAGACATCC CCTCGGGTTTCCACGTCTC
After finding abnormal levels of a substance called adipsin in overweight rodents, researchers in Boston said last week that adipsin may be a contender for the adipostat title, as well as a marker to differentiate among obesities due to defects in genes, metabolism or just plain will power.
Reported in the July 24 SCIENCE, experimentsby scientists at Beth Israel Hospital and Harvard Medical School showed that adipsin is primarily found in adipose tissue (fat), is carried in the bloodstream and is produced in abnormal levels in certain types of obesity.
MS-based peptide fingerprinting identified many of these proteins as previously described adipokines with typical secretory signal peptides such as adiponectin, adipsin, complement factor 3, and others (data not shown).