acyl-CoA synthetase

ac·yl-CoA syn·the·tase

1. general term for enzymes that form acyl-CoA, now called ligases;
2. specifically, long-chain fatty acid-CoA ligase.

acyl-CoA synthetase

(1) Long-chain-fatty-acid-CoA ligase, EC 6.2.1.3 (long-chain-fatty-acid-CoA:ligase (AMP-forming)).
(2) Any enzyme that forms acyl-CoA, ligases (EC 6.2.1.x).
References in periodicals archive ?
To further confirm the reliability of DMRs analysis, the methylation level of four randomly selected DMRs in gene acyl-CoA oxidase 2 (ACOX2) intron, acyl-CoA synthetase long chain family member 1 (ACSL1) CDS region, and upstream regions of ras and rab interactor 2 (RIN2) and zinc finger, DHHC type containing 13 (ZDHHC13) were analyzed by BSP.
Acyl-CoA Synthetase and Acetyl-CoA Synthetase are enzymes present in the fatty acid metabolism, preserved in D.
ACSL6 encodes for acyl-CoA synthetase long-chain family member 6, a protein that catalyzes formation of acyl-CoA from fatty acids.
Primer sequences for acetyl-CoA acyltransferase (ACAA2), long-chain acyl-CoA dehydrogenase (ACADL), acyl-CoA synthetase (ACSL1), very long chain acyl-CoA dehydrogenase (ACADVL), carnitine palmitoyltransferase 1B (CPT1B), enoyl-CoA hydratase (ECH1), hydroxyacyl-CoA dehydrogenase (HADHA), pyruvate dehydrogenase kinase (PDK4), PGC-1[alpha], PGC-1[beta], PPAR[alpha], glutamate dehydrogenase, and 18S ribosomal RNA are available in Supplemental Material, Table S1 (http://dx.
FA are activated by acyl-CoA synthetase on the peroxisomal membrane and the entry into the organelle is independent ofcarnitine.
This requires their activation by long chain fatty acyl-CoA synthetase, on the outer mitochondrial membrane, to generate long chain fatty acyl-CoA.
The acyl residues are exported to the cytoplasm and converted to acyl-CoA esters by acyl-CoA synthetase, thereby producing substrates that are further elongated in species that produce VLCs and further desaturated in species that produce polyunsaturated fatty acids.
Nucleotide sequences of primers used for qRT-PCR amplification Target gene Forward (5'-3') Reverse (5'-3') [beta]-actin TTGTATCTTCCGCCTTAA GCCTTCATTCACATCTATC ACSL3 CGTGCCTAATGGTTACTT TTCCTGCTGTGTTAATATCA PPP1R3A GAATGACACTGGATGACT TCTGATAAGGAGGCACTA MTMR7 AATGAATACGCTTGCTTAG CTGGTTGAGAGTTGAGTA FSH[beta] TCCTCTACTCTGTTCAAT GGTCTCTATTCATTCTTACTA SMURF2 GTCAGATTCAATAACAAT CCTCTAACAGTATCATTA Target gene Length (bp) [beta]-actin 98 ACSL3 136 PPP1R3A 120 MTMR7 105 FSH[beta] 127 SMURF2 177 qRT-PCR, real-time quantitative polymerase chain reaction; ACSL3, acyl-CoA synthetase long-chain family member 3; PPP1R3A, protein phosphatase 1 regulatory subunit 3A; MTMR7, myotubularin related protein 7; FSH[beta], follicle stimulating hormone beta; SMURF2, SMAD specific E3 ubiquitin protein ligase 2.
The nine target genes were acyl-CoA synthetase long-chain family member 6 (ACSL6), apolipoprotein A-I (APOA1), PLTP, GK, CPT2, aquaporin 7 (AQP7), acyl-Coenzyme A oxidase 1 palmitoyl (ACOX1), ACOX2, and FABP4.
In this study, DR did not affect the expression of several genes in the LM for lipid metabolism (adipose triglyceride lipase, acyl-CoA synthetase long-chain family member, glycerol-3-phosphate acyltransferase, and hydroxyacyl-Coenzyme A dehydrogenase) and fatty acid uptake (fatty acid translocase and lipoprotein lipase) at both P1 and P2.

Full browser ?