acetyl-CoA


Also found in: Dictionary, Encyclopedia, Wikipedia.
Related to acetyl-CoA: NADH, pyruvate, Acetyl-CoA carboxylase

a·ce·tyl-CoA

(a-sĕ'til),
Condensation product of coenzyme A and acetic acid, symbolized as CoAS~COCH3 or as AcCoa; an intermediate in the transfer of two-carbon fragments, notably in the tricarboxylic acid cycle and in fatty acid synthesis.

acetyl-CoA

(ə-sēt′l-kō′ā′, ăs′ĭ-tl-)

Acetyl-CoA

A coenzyme derivative in the metabolism of glucose and fatty acids that contributes substrates to the Krebs cycle. Acetyl CoA provides the acetyl for multiple biochemical reactions and plays a key role in intermediary metabolism—synthesis, catabolism, or use of nutrients for energy production and growth.

acetyl-CoA

Acetylcoenzyme A Metabolism A coenzyme derivative in the metabolism of glucose and fatty acids that contributes substrates to the Krebs cycle; acetyl CoA provides the acetyl unit for multiple biochemical reactions and plays a central role in intermediary metabolism–synthesis, catabolism, or use of nutrients for energy production and growth. See Citric acid cycle.

a·ce·tyl-CoA

(as'ĕ-til)
Condensation product of coenzyme A and acetic acid, symbolized as CoAS∼COCH3; intermediate in transfer of two-carbon fragment, notably in its entrance into the tricarboxylic acid cycle and in fatty acid synthesis.
References in periodicals archive ?
size (bp) Adpn R1 AM886136 F: CGGCTCATCTACCTCTCCAT 109 R: ACACACCTGCTCTTGTCTGC Adpn R2 AM886135 F: CTGGCTCAAGGATAACGACTT 109 R: AATGTTGCCTGTCTCTGTGTG INSR XM_008249177 F: CGCTACCAATCCTTCTGTCC 111 R: TAGTGCGTGATGTTGCCATT LEPR XM_008265107 F:AAGAACAGAGATGAGGTGGTGC 187 R:CCAGTGTGGCGTATTTCACG ACC XM_008271160 F: TGGCTGTATCCATTATGTCAAGCG 235 R: TGAAGAAAGGGTCAGGAAGGCAGTA CPT1 XM_002724092 F: AGGTGCTCCTCTCCTACCACGG 379 R: GTTGCTGTTCACCATCAGTGGC GAPDH NM_001082253 F: TGCCACCCACTCCTCTACCTTCG 163 R: CCGGTGGTTTGAGGGCTCTTACT Adpn R, adiponectin receptor; INSR, insulin receptor; LEPR, leptin receptor; ACC, Acetyl-CoA carboxylase; CPT1, carnitine palmitoyltransferase 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
The TaqMan primer/probe sets for FASN (Hs01005622_ml), acetyl-CoA carboxylase [alpha] (ACACA, Hs01046047_ml), sterol regulatory element binding transcription factor 1 (SREBF1, Hs01088691_ml), stearoyl-CoA desaturase (SCD, Hs01682761_ml), nuclear receptor subfamily 1, group H, member (NR1H) 3 (LXR-[alpha], Hs00172885_ml), NR1H2 (LXR-[beta], Hs01027215_gl), RXR-[alpha] (Hs01067640_ml), and actin, beta (ACTS, Hs01060665_gl) were purchased from Applied Biosystems (CA, USA).
When the generation of Acetyl-CoA exceeds the capacity of oxaloacetate, the Acetyl-CoA is then diverted to the synthesis of ketone bodies, Figure IB, which include [beta]-hydroxybutyrate, acetoacetate, and acetone.
III] inhibition or to increased acetyl-CoA negative feedback) or decreased lactate dehydrogenase activity, which is unlikely, owing to a strong association between lactate dehydrogenase activity and arsenical exposure (Liao et al.
Acetyl-CoA in the glyoxylate cycle binds with oxaloacetate, respectively producing citrate and isocitrate.
Additionally, an increase in the enzymes present in the metabolism of fatty acids, such as Acetyl-CoA Synthetase (ACeCS1) and Acyl-CoA Synthetase (ACSL1), and an induction of oxidative stress were observed.
DMC activated AMPK and in turn decreased the activity and/or expression of lipogenic enzymes, such as fatty acid synthase (FASN) and acetyl-CoA carboxylase (ACC).
Overproduction of acetyl-coA during extensive [beta]-oxidation causes the blockage of pyruvate dehydrogenase.
Tricarboxylic acid (TCA) cycle: A series of biochemical reactions that serve to generate energy from the metabolism of acetyl-CoA, which in turn is derived from the metabolism of sugars, fats, and proteins; also called citric acid cycle.
The fluazifop-p-butyl, an inhibitor of the ACCase enzyme, found in plastids stoma, converts acetyl-CoA into malonyl-CoA by adding a molecule of C[O.
2000) demonstrates that an excessive ACh release, evoked by Al, is likely to increase acetyl-CoA utilization for re-synthesis of the neurotransmitter pool and cause deficit of this metabolite in differentiated cells.
4,5) In this pathway, three molecules of acetyl-CoA condense successively to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) (Fig.

Full browser ?